color output was difficult to save in text file

You can do it. It depends of the desired output format... want a yummy pdf?

my $dna = "AAAAAACAAACAAACCCAATATATATATACGACATATATTATATATTATACCCCGGG";
my $preciouss = substr $dna, 15, 28;
 
open (my $output, '>', "latex_file.tex");

print $output "\\documentclass{article}\n\\usepackage{color}\n";
print $output "\\begin{document}\n";
print $output "THIS IS MY BORING GENE: \\textcolor{red}{", $preciouss,
+ "}\\\\\\textcolor{blue}{OKAY, OKAY... \\textit{NOT SO BORING}, {\\bf
+ IS RED!}}";
print $output "\n\\end{document}";

close $output;

system("pdflatex latex_file.tex");
system("xpdf latex_file.pdf &");
[download]

You will need to have installed a decent tex distro and xpdf. See texlive. You can also translate to html, dvi or postscript easily from here, as you will