in reply to Re^5: substrings that consist of repeating characters
in thread substrings that consist of repeating characters
Aja, that has allowed me to see the problem!
The (*SKIP) inside the repetition always matches, but once the end of the same-char sequence is reached the \2 fails, so it causes the repetition to backtrack, but it can't because of the (*SKIP), so all the repetition fails!
Moving the (*SKIP) after the \2 fixes the issue:
my $string = "ATTTAGTTCTTAAGGCTGACATCGGTTTACGTCAGCGTTACCCCCCAAGTTTTTTT +TTTTTTTTTTTATTGGGGACTTT"; my $len = 0; my $best = ""; while ($string =~ /((.)(\2(*SKIP)){$len,})/g) { $len = length $1; $best = $1 } print "best: $best\n"
|
---|
In Section
Seekers of Perl Wisdom