On the crossroads

Replies are listed 'Best First'.
Re: On the crossroads by TVSET (Chaplain) on Oct 22, 2003 at 22:03 UTC
Well, without any specifics of your task you are basically asking for statistics on CPAN module usage. :) I'd say that, considering the fact that most Perl programs deal with web and databases (at least throughout my experience), you will not waste your time if you'll brush through CGI and DBI. But that you already knew most probably. :) So, you might try something that works with dates, like Date::Calc or Date::Manip. Maybe, some database abstraction modules might do some good - check out Class::DBI and DBIx::Abstract. That is as far as I can go without specifics. :) Leonid Mamtchenkov aka TVSET	[reply]
Re: On the crossroads by jacques (Priest) on Oct 22, 2003 at 22:16 UTC
See the Phalanx project's top 100. http://qa.perl.org/phalanx/ I know I can just plunge into CPAN, read documentation to every module there. Only if you are a robot.	[reply]
Re: On the crossroads by Abigail-II (Bishop) on Oct 22, 2003 at 22:13 UTC
Unless you tell us what you want to do, this is a bit of a silly question. There will be tons of people who use CGI and all kinds of other modules, because all, or a larger portion of their Perl coding involves the web. Other, like me, avoid web coding like the plague, and will not use any of those modules. Most of my programs won't use any CPAN modules at all. It's not that I code the functionality myself, but the programs are short enough that it's not needed. If I look at which standard modules I use most often, the following spring out: strict, warnings, constant, lib, Exporter, Fcntl, POSIX, and GetOpt::Long. Abigail	[reply]
Re: On the crossroads by TomDLux (Vicar) on Oct 22, 2003 at 22:16 UTC
Start with the modules in the core distribution. There's a reason they are distributed to everyone. If you are new to Perl, you should be reading tutorials and articles wherever you can find them, most of all master monks such as Merlyn, MJD, Damian, Simon Cozens, ... What modules do they use in their articles? -- `TTTATCGGTCGTTATATAGATGTTTGCA`	[reply]
Re: On the crossroads by greenFox (Vicar) on Oct 23, 2003 at 04:04 UTC
Without knowing what you are intending to write it's pretty hard to recomend specific modules but you could look at Favourite modules April 2003 and it's parent Favourite modules March 2002. Another good place to look is Tutorials, if you are considering writing your own modules I recommend tachyon's excellent Simple Module Tutorial. -- Do not seek to follow in the footsteps of the wise. Seek what they sought. -Basho	[reply]
Re: On the crossroads by Zaxo (Archbishop) on Oct 23, 2003 at 02:12 UTC
Graph and PDL are each incredibly useful at times. After Compline, Zaxo	[reply]
Re^2: On the crossroads by etj (Deacon) on Jun 26, 2022 at 01:15 UTC
As the (obviously biased) maintainer of both, I agree. To spell out the uses for each: Graph: for an object capturing "things", and "connections between things", with some well-known algorithms such as shortest-path, connected components PDL: for array-programming, high-performance maths including matrix maths including physics, image processing, 3D graphics, and similar data-crunching things (and anything handling binary data, really) By the way, spoiler alert: quite a lot of graph-theory stuff can (and should) be modelled with matrix-maths stuff.	[reply]
Re: On the crossroads by jdtoronto (Prior) on Oct 23, 2003 at 01:17 UTC
Aprt from the ones above: CGI::Session if you are doing CGI work. Text::CSV_XS if you handle ,csv or txt files of data SQL::Abstract is not always PC around here but it is very useful in the right place As others have said, be a little more specific about what foo is and we will be more forthcoming about our favourites. But that selection along with the ones TVSET mentioned would be my "Swiss Army Chain Saw" of Perl modules. jdtoronto	[reply]
Re: On the crossroads by valdez (Monsignor) on Oct 23, 2003 at 10:21 UTC
I found very useful to watch every morning at Recent Uploads on CPAN, there I found many interesting things (see also Mining the hidden gems of CPAN by adrianh). Another interesting way of knowing about modules usage is the Most Often Mentioned Modules node. Ciao, Valerio	[reply]
Re: On the crossroads by Aragorn (Curate) on Oct 23, 2003 at 07:26 UTC
There are modules for an insanely wide variety of tasks, so specific pointers are a bit hard to give. Like it was said before, start with the modules in the core distribution. Reading the documentation about all the modules on CPAN is indeed a big task, but the division in categories and subcategories is a very useful feature. Browse the docs on a module you think is appropriate for the problem at hand, see what (if any) rating it has. Search PerlMonks for opinions that people have about that specific module. And, very important, use the module in some small script, just to test it out. Reading the docs is important, but getting a feel for its usefulness comes from actually using it. Arjen	[reply]
Re: On the crossroads by bakunin (Scribe) on Oct 23, 2003 at 13:20 UTC
I don't think this is a silly question, but I aggree that it could have been focused to a certain subject. Please Google or search.cpan the names :))) 1. POE for multitasking 2. PerlQT for nice GUIs 3. ming-perl for Dynamic SWF generation (my subject) or the SWF module from CPAN, don't used it. 4. Class::MethodMaker /Class::MakeMethods from CPAN for OOP 5. as monks pointed out, definely Class::DBI 6. dig through perl.com articles 7. definetely look what the standard distribution brings to our homes. (Someting I have to do myself!) I haven't used some of these modules, for my projects I've been growing this list in my mind for some time. So many modules to learn!!	[reply]
Re: On the crossroads by Anonymous Monk on Oct 27, 2003 at 03:22 UTC
This is out of date. It is not a complete list of interesting packages. It is designed to pull in other packages. Archive.pm package Bundle::Archive; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::Archive =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::Archive'> =head1 CONTENTS Compress::LZF Compress::LZV1 Compress::Zlib Convert::ASN1 Convert::BER Archive::Tar =head1 DESCRIPTION =head1 AUTHOR Pat Monardo Data.pm package Bundle::Data; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::Data =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::Data'> =head1 CONTENTS Bit::ShiftReg Bit::Vector Set::Bag Set::Range Set::IntRange Set::IntSpan Set::NestedGroups Set::Object Set::Scalar Set::Window Data::Dumper Data::MultiValuedHash Data::ShowTable Data::Walker Storable =head1 DESCRIPTION =head1 AUTHOR Pat Monardo Database.pm package Bundle::Database; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::Database =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::Database'> =head1 CONTENTS GDBM_File DB_File BerkeleyDB DBI DBD::mysql MLDBM =head1 DESCRIPTION =head1 AUTHOR Pat Monardo Date.pm package Bundle::Date; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::Date =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::Date'> =head1 CONTENTS Date::Calc Date::Convert Date::Format Date::GetDate Date::ISO Date::Language Date::Manip Date::Ordinal Date::Parse Date::Pcalc Time::CTime Time::DaysInMonth Time::HiRes Time::Period Time::Timezone Time::Zone =head1 DESCRIPTION =head1 AUTHOR Pat Monardo Devel.pm package Bundle::Devel; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::Devel =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::Devel'> =head1 CONTENTS Env::Array Devel::Symdump Params::Validate =head1 DESCRIPTION =head1 AUTHOR Pat Monardo File.pm package Bundle::File; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::File =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::File'> =head1 CONTENTS File::MMagic File::Spec File::PathConvert File::FlockDir File::Remote File::Cat File::Sort =head1 DESCRIPTION =head1 AUTHOR Pat Monardo IO.pm package Bundle::IO; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::IO =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::IO'> =head1 CONTENTS IO::String IO::Stringy IO::SendFile IO::Cat IO::LockedFile IO::Tee IO::Multiplex IO::Pipe IO::Interface IO::Sockatmark IO::Socket::UNIX IO::Socket::Multicast IO::Zlib IO::Default IO::Null =head1 DESCRIPTION =head1 AUTHOR Pat Monardo Image.pm package Bundle::Image; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::Image =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::Image'> =head1 CONTENTS GD GD::Text GD::Graph Image::Size =head1 DESCRIPTION =head1 AUTHOR Pat Monardo Mail.pm package Bundle::Mail; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::Mail =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::Mail'> =head1 CONTENTS Mail::Alias Mail::Audit Mail::Util Mail::Sendmail =head1 DESCRIPTION =head1 AUTHOR Pat Monardo Net.pm package Bundle::Net; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::Net =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::Net'> =head1 CONTENTS Net::SSLeay IO::Socket::SSL Net::LDAP =head1 DESCRIPTION =head1 AUTHOR Pat Monardo Security.pm package Bundle::Security; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::Security =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::Security'> =head1 CONTENTS Digest::MD5 Digest::MD2 Digest::SHA1 Digest::HMAC Digest::HMAC_MD5 Digest::HMAC_SHA1 Digest MD5 =head1 DESCRIPTION =head1 AUTHOR Pat Monardo String.pm package Bundle::String; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::String =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::String'> =head1 CONTENTS Parse::Yapp Font::AFM =head1 DESCRIPTION =head1 AUTHOR Pat Monardo UI.pm package Bundle::UI; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::UI =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::UI'> =head1 CONTENTS Term::Info Term::ReadKey Term::ReadLine::Perl Term::Size =head1 DESCRIPTION =head1 AUTHOR Pat Monardo Web.pm package Bundle::Web; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::Web =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::Web'> =head1 CONTENTS MIME::Base64 MIME::Lite URI HTML::Parser HTML::Tagset HTML::Tree LWP Apache::DB Apache::DBI =head1 DESCRIPTION =head1 AUTHOR Pat Monardo XML.pm package Bundle::XML; $VERSION = '0.1'; 1; __END__ =head1 NAME Bundle::XML =head1 SYNOPSIS C<perl -MCPAN -e 'install Bundle::XML'> =head1 CONTENTS XML::Parser XML::Parser::PerlSAX XML::Encoding XML::DOM XML::XQL XML::RSS #XML::Sablotron XML::Dumper =head1 DESCRIPTION =head1 AUTHOR Pat Monardo [download]	[reply] [d/l]


Your skill will accomplish what the force of many cannot
	PerlMonks