CB database tool (work in progress)

use warnings;
use strict;
use LWP::Simple;
use DBI;

my $data    = '';
my $dbh     = '';
my $url     = 'http://www.perlmonks.org/?node_id=207304';
my $pat     = qr{ <author>(.*?)<\/author>.*?<text>(.*?)<\/text> }xs;
$dbh        = DBI->connect( "dbi:SQLite:dbname=C:\\testdb", "", "" );

$data = get( $url );

while ($data =~ m/$pat/msg) {
   my ($auth, $text) = ($1, $2);

   for( $text ) {
      s/[ ]+/ /g;
      s/^\s+//;
      s/\s+$//;
   }

   printf "%s: %s\n\n" , $auth , $text;

   $dbh->do('insert into monks values(?,?)', undef, $auth, $text );
}
[download]

use warnings;
use strict;
use Switch;

my $dna            = 'atctcttttcgtctgctttggggtttgtcctataggcta';
my $base           = '';
my @bases          = ();
my $a              = '';
my $c              = '';
my $g              = '';
my $t              = '';
my $err            = 0;
my $total          = 0;

calc_base( $dna );

sub calc_base {
   my ( $dna ) = @_;

   print 'Please enter a base to calculate: ';
   chomp( $base = <STDIN> );

   @bases            = split '', $dna;
   $total            = length $dna;

   for( @bases ) {
      ++$a if /a/;
      ++$c if /c/;
      ++$g if /g/;
      ++$t if /t/;
      ++$err if /[^acgt]/;
   }

   switch ( $base ) {
      case "a" { printf "The amount of adenosine in the sequence is %.
+2f%%",
                        ( ($a/$total) * 100); }
      case "c" { printf "The amount of cytosine in the sequence is %.2
+f%%",
                        ( ($c/$total) * 100); }
      case "g" { printf "The amount of guanine in the sequence is %.2f
+%%",
                        ( ($g/$total) * 100); }
      case "t" { printf "The amount of thymidine in the sequence is %.
+2f%%",
                        ( ($t/$total) * 100); }
   }
}
[download]