Re^2: non-exact regexp matches

I refined my question a little more. I have a string of letters [ACGTacgtNn] from which I want to find a particular instance of a regexp, let's say:

/ACCAAC[ACGTacgtNn]{6}CTA[ACGTacgtNn]{1}ATG[ACGTacgtNn]{1,2}GATGTT/
[download]

I can do this just fine, but what if I want to match the above regexp with a tolerance of 2 minmatches for single characters. Below I have an example:

$buf =~ m/(A)(C)(C)(A)(A)(C)([ACGTacgtNn]{6})(CTA[ACGTacgtNn]{1})(A)(T
+)(G)([ACGTacgtNn]{1,2})(G)(A)(T)(G)(T)(T)(?{
    print $-[0]," ",scalar@-,"\n";
    })(?!)/;
[download]

this will print the position of the match in $buf, followed by 19 (the number of submatches). I want to be able to return a match from 17-19 submathes, not just all 19. Thanks. Vince

Comment on Re^2: non-exact regexp matches Select or Download Code

Replies are listed 'Best First'.
Re: non-exact regexp matches by Abigail-II (Bishop) on Jun 23, 2004 at 20:57 UTC
Will this do? `use re 'eval'; no strict 'refs'; if (/(A)?(C)?(C)?(A)?(A)?(C)?([ACGTacgtNn]{6})?(CTA[ACGTacgtNn]{1} +)? (A)?(T)?(G)?([ACGTacgtNn]{1,2})?(G)?(A)?(T)?(G)?(T)?(T)? (?(?{17 <= grep {defined $$_} 1 .. 19})\|(?!))/x) { ... }` [download] Abigail	[reply] [d/l]
Re^2: non-exact regexp matches by Anonymous Monk on Jun 25, 2004 at 15:14 UTC
Hi, I tested your program on the following sequence: `ACCAACCGGATTCTAGATGCAGATGTTGAAGATT # works OK. Change the second C for a G: AGCAACCGGATTCTAGATGCAGATGTTGAAGATT # Doesn't work.` [download] I'm looking over your regexp... bu it'll take me a while to figure it out. Thanks for the help. Vince	[reply] [d/l]
Re^3: non-exact regexp matches by japhy (Canon) on Jun 25, 2004 at 15:22 UTC
That's because Abigail-II's regex only handles the case of deletions. To support insertions and modifications, you need a more robust approach. _____________________________________________________ Jeff`[japhy]`Pinyan: Perl, regex, and perl hacker, who'd like a job (NYC-area) `s++=END;++y(;-P)}y js++=;shajsj<++y(p-q)}?print:??;`	[reply]
Re^4: non-exact regexp matches by vinforget (Beadle) on Jun 25, 2004 at 16:37 UTC


Come for the quick hacks, stay for the epiphanies.
	PerlMonks