If the 'pretty long' string is 'long enough' and you have a lot of keywords, you might be better off using a non-regex solution. The example below creates an index of $string, so finding exact matches is fast. Using very short substrings for the index will not be very efficient, though, so if your keywords are only a few characters a regex might be better.
This example uses a snippet of DNA sequence for $string and an arbitrary substring length of 3 (but that could be set based on the length of the shortest element in @keywords instead). The location of all the matches are stored in %matches, but you could speed things up by just incrementing a counter if you didn't need them for anything later.
use strict;
use warnings;
my $string = 'ccaaactcagtggggtgaatggggcttctctgtgctctgatagcttccctaccctt
+tcccttctccagctcccgtcccttctgactgtgagcagccccctcctctccactgttcccctcctgttg
+tcagaggagggcccagctgaggcagggactggaccaccggctggggtgtccctaggggtcttgggtggc
+tggcagtagtggagcctggggctgagaggggaagcaaaataagattgtcctccaacttagccatcctca
+ggcctgctggggctatttaactggctgggcctgcatggcgacagggcccctacagcctccctgggaaca
+aggggtgaagggttcagggggaagggggtcacagagtgatggagaaacctcttgagaacaaactaggct
+ccctcatgctggagtccaaggctgagtacctcccttctctgaaacagagcaacaaccccactcccaccc
+cgagtctgtc';
my @keywords = qw( ttc gctg ccaac ggggct ccc );
my $substrlen = 3; # or use length of shortest element in @keywords
# create an index of all substrings of length $string
my %substrings;
for( my $i = 0; $i <= length($string) - $substrlen; $i++ )
{
my $substring = substr( $string, $i, $substrlen );
push( @{ $substrings{$substring}{hits} }, $i );
}
# search the index for all elements of @keywords
my %matches;
foreach my $keyword ( @keywords )
{
my $subkey = substr( $keyword, 0, $substrlen );
if( exists $substrings{$subkey} )
{
foreach my $hit ( @{ $substrings{$subkey}{hits} } )
{
if( $keyword eq substr($string, $hit, length($keyword)) )
{
push( @{ $matches{$keyword} }, $hit );
}
}
}
}
foreach my $keyword ( keys %matches )
{
print "Found $keyword ", scalar @{ $matches{$keyword} };
printf " time%s at position%s: ",
scalar @{ $matches{$keyword} } > 1 ? 's' : '',
scalar @{ $matches{$keyword} } > 1 ? 's' : '';
print join( ', ', @{ $matches{$keyword} } ), "\n";
}
** OUTPUT **
Found gctg 8 times at positions: 140, 164, 192, 214, 268, 286, 408, 42
+1
Found ttc 8 times at positions: 25, 44, 55, 60, 78, 111, 344, 435
Found ccaac 1 time at position: 245
Found ccc 22 times at positions: 46, 51, 57, 70, 75, 94, 95, 96, 113,
+114, 136, 174, 309, 310, 321, 401, 432, 456, 457, 463, 467, 468
Found ggggct 3 times at positions: 20, 211, 271
I just thought a different approach might be interesting. YMMV. I'm sure there is a break even point between creating a regex with a lot of alternation and the time spent creating the index. I'd recommend benchmarking a few methods with some of your actual data to see what works best.