Hi I have a fasta file containing a number of sequences. I would like to extract only the sequences that are of a specific length (lets's say >10 nt). The sequences are wrapped with new lines, so when trying to read into an array, each line becomes an element. How can I removed these? I have tried join, but it also removes the newline between sequences and puts all of it into single string. How do I separate each sequence into an element or string?

The file looks something like this:

>NM_001 Homo sapiens ADA2 (CECR1)
GATCCAA
>NM_002 Homo sapiens IKBKG
GGAGGTCTTTAGCTTTAGGGAAACCC
[download]

Output should be only the second sequence in this case.

#!/usr/bin/perl -w


#open the fastfile Genes.fasta
open (GENES, "Genes.fasta") or die "Could not open file";
chomp (@seq = <GENES>);
$seq = join ("\n", @seq);

$lengthseq = length $seq;

#min length of the seq
$minlength = 10;

#if length is over a certain size, print
if ($lengthseq > $minlength){
    print $seq;
    }
else {print "No sequence is over $minlength;"
}
[download]

---

---

• Are you posting in the right place? Check out Where do I post X? to know for sure.
• Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:

  <code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>

• Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
• Want more info? How to link or How to display code and escape characters are good places to start.