Tasks like this can be solved by using BioPerl.
use strict;
use warnings;
use Bio::SeqIO;
# Reading the fasta file
my $seqio_obj = Bio::SeqIO->new(-file => "Genes.fasta",
-format => "fasta" );
# Looping through sequences and printing them unless length <= 10
+
while ( my $seq_obj = $seqio_obj->next_seq ) {
print $seq_obj->seq,"\n" unless $seq_obj->length <= 10;
}
# The output should be : "GGAGGTCTTTAGCTTTAGGGAAACCC".
-
Are you posting in the right place? Check out Where do I post X? to know for sure.
-
Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
<code> <a> <b> <big>
<blockquote> <br /> <dd>
<dl> <dt> <em> <font>
<h1> <h2> <h3> <h4>
<h5> <h6> <hr /> <i>
<li> <nbsp> <ol> <p>
<small> <strike> <strong>
<sub> <sup> <table>
<td> <th> <tr> <tt>
<u> <ul>
-
Snippets of code should be wrapped in
<code> tags not
<pre> tags. In fact, <pre>
tags should generally be avoided. If they must
be used, extreme care should be
taken to ensure that their contents do not
have long lines (<70 chars), in order to prevent
horizontal scrolling (and possible janitor
intervention).
-
Want more info? How to link
or How to display code and escape characters
are good places to start.
|