Aja, that has allowed me to see the problem!
The (*SKIP) inside the repetition always matches, but once the end of the same-char sequence is reached the \2 fails, so it causes the repetition to backtrack, but it can't because of the (*SKIP), so all the repetition fails!
Moving the (*SKIP) after the \2 fixes the issue:
my $string = "ATTTAGTTCTTAAGGCTGACATCGGTTTACGTCAGCGTTACCCCCCAAGTTTTTTT
+TTTTTTTTTTTATTGGGGACTTT";
my $len = 0;
my $best = "";
while ($string =~ /((.)(\2(*SKIP)){$len,})/g) {
$len = length $1;
$best = $1
}
print "best: $best\n"
-
Are you posting in the right place? Check out Where do I post X? to know for sure.
-
Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
<code> <a> <b> <big>
<blockquote> <br /> <dd>
<dl> <dt> <em> <font>
<h1> <h2> <h3> <h4>
<h5> <h6> <hr /> <i>
<li> <nbsp> <ol> <p>
<small> <strike> <strong>
<sub> <sup> <table>
<td> <th> <tr> <tt>
<u> <ul>
-
Snippets of code should be wrapped in
<code> tags not
<pre> tags. In fact, <pre>
tags should generally be avoided. If they must
be used, extreme care should be
taken to ensure that their contents do not
have long lines (<70 chars), in order to prevent
horizontal scrolling (and possible janitor
intervention).
-
Want more info? How to link or
or How to display code and escape characters
are good places to start.
|