Re: The most useless key on my keyboard is:
by kelan (Deacon) on Nov 16, 2005 at 18:49 UTC
|
The Windows key is still useful under Linux. My window manager, and I imagine most others, can use it as another modifier key. I think it maps to Hyper in mine. I have it set to do all sorts of things when combined with different letters: open an xterm, toggle window maximization, display the WM's window menu, etc. It's a nice place for shortcuts because it doesn't get in the way of regular application shortcuts like Ctrl or Alt would.
On the other hand, I have not used a program in the last 10 years that used F12 for anything. That key got my vote.
| [reply] |
|
|
On the other hand, I have not used a program in the last 10 years that used F12 for anything. That key got my vote.
I use the F12 key whenever I leave my desk: it locks my screen:
$ grep F12 ~/.fvwm2rc
Key F12 A N Exec xscreensaver-command -lock
| [reply] [d/l] |
|
|
| [reply] |
|
|
I have syslog set to log mostly everything to vt12, so I use alt-F12 (or C-A-F12) to see what's going on fairly often. That's worth something, right?
| [reply] |
|
|
In Macromedia Flash, I use Ctrl+F12 to publish the flash movie.
Some use F12 to publish and preview, but since it keeps trying to open IE, I never
use it that way.
In Adobe Photoshop, F12 is the default shortcut for "Revert" which gets some uses from time to time when you mess up something real bad.
That's on windows. I have no use for it yet on my linux desktop.
He who asks will be a fool for five minutes, but he who doesn't ask will
remain a fool for life.
Chady | http://chady.net/
| [reply] |
|
|
| [reply] |
|
|
F12 brings up a quick preferences window in Opera. It has options to toggle javascript, animated gifs, etc.
| [reply] |
Re: The most useless key on my keyboard is:
by jdporter (Paladin) on Nov 16, 2005 at 20:06 UTC
|
Everything outside the standard typewriter keyboard area. Because I use vi. (Same goes for the mouse.)
We're building the house of the future together.
| [reply] [d/l] |
Re: The most useless key on my keyboard is:
by Nkuvu (Priest) on Nov 16, 2005 at 20:25 UTC
|
The "Windows" key. Mostly because it's pure evil when I'm playing games and hit the key accidentally.
I mean, I never play games, I am a totally serious programmer who doesn't have time for games.
| [reply] |
|
|
Oh I agree. Nothing worse than getting owned while you accidentally hit the windows key.
| [reply] |
|
|
| [reply] |
|
|
I actually use a program called SharpKeys to remap the Windows key to something else, like the Alt key. So it's not really a question of how to do it, it's a mention that I find the key utterly useless (and "harmful" in certain senses of the word).
| [reply] |
|
|
I totally agree. It's worst when I'm playing on someone else's keyboard and expect to hit Alt and find some pointless Windows key making my start menu blink in the foreground and overloading my video card.. Luckily, with some VOIP software you can map the windows key to a command and block Windows from interpreting it.
As to the thread question.. It really depends on the applications you use, but I definitely appreciate having a few spare buttons around for mapping. For instance, while running TeamSpeak I use Pause to mute speakers, XFire I believe uses Scroll Lock + X for in-game functions, et cetera. The most valuable (non-alphanumeric) buttonset on my keyboard is definitely music controls. But there isn't really a key I don't use. Page Down? Yeah, the keyboard scroll wheel is what I use for that..
| [reply] |
Re: The most useless key on my keyboard is:
by talexb (Chancellor) on Nov 16, 2005 at 19:34 UTC
|
I use Windowmaker on X Windows, and F12 pops up a list of open windows -- I use it daily.
I just tried the Windows (tm) key and got nothin'. I guess Windowmaker isn't set up to do anything with that key.
Certainly the most unused keys on my keyboard are the three loners:
[Print] [Scroll] [Pause]
[Scrn ] [Lock ] [ ]
[ ] [ ] [ ]
[SysRq] [ ] [Break]
I think ^P used to do a Print Screen under DOS, but I haven't used that feature in ages. No idea what Scroll Lock does. I think Pause does a ^S/^Q toggle, like XOFF/XON, and I guess Break does a ^C.
I also have a bunch of browser buttons -- Back, Forward, Stop, Mail, Search, Favourites, Web/Home, and also My Computer, Calculator and Sleep. Never pressed any of them -- certainly not the Sleep button -- that way madness lies.
The funniest thing on my keyboard is the lovely silk-screened Microsoft (tm) logo. Heh, Red Hat Linux on this workstation for the last three years, pal.
Alex / talexb / Toronto
"Groklaw is the open-source mentality applied to legal research" ~ Linus Torvalds
| [reply] [d/l] |
|
|
Normally, the cursor keys change the cursor position. When Scroll Lock is on, the cursor keys move the view instead. In other words, Scroll Lock causes the cursor keys to act like they do when viewing an HTML page in Firefox and IE. Spreadsheet software usually support it.
| [reply] |
|
|
Wow. That's so cool. I was going to vote for ScrollLock but read the replies before voting. I'm glad I did. This sounds like a key I'll have much use for, if the things I use actually support it.
I've used PrtScr several times in the last few weeks (it stuffs the current screen contents into the paste buffer so I can crop them and include them in e-mail to managers who like their facts in the form of pretty pictures). :)
Just for the sake of tradition, I'll note that the best answer was omitted. NumbLock, which should always be "on" (unless you have a miniature keyboard as part of some miniature device, of course).
| [reply] |
|
|
P:\test>p1 ## ^C
perl> Terminating on signal SIGINT(2)
P:\test>p1 ## ^Break
perl> Terminating on signal SIGBREAK(21)
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
Lingua non convalesco, consenesco et abolesco. -- Rule 1 has a caveat! -- Who broke the cabal?
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.
| [reply] [d/l] |
|
|
I use Windowmaker on X Windows, and F12 pops up a list of open windows -- I use it daily.
I also use WindowMaker on one of my home machines but I didn't know this. Thanks for the info. :)
| [reply] |
|
|
You're welcome -- since I started using Xwindows and Windowmaker, I can't imagine going back to Windows with a single desktop, and I'm really quite surprised that no one's done anything to address that on Windows.
At work I'm set up with 10 desktops on a dual-headed system:
- E-Mail (mutt), IM (Gaim)
- Monitoring 1 (browser on Nagios, xterm on qstat (for the Sun Grid Engine), xload on the various servers I need to watch)
- Monitoring 2 (tabbed browser on the Production systems)
- Development (browser, various xterm ssh sessions, Razor bug tracking)
- Sometimes Development, sometimes Support
- Spare
- Spare
- Sometimes additional browsing
- Personal (browser on GMail, Slash, Groklaw, PerlMonks)
No way would I be able to fit all that on any Windows desktop.
Alex / talexb / Toronto
"Groklaw is the open-source mentality applied to legal research" ~ Linus Torvalds
| [reply] |
|
|
|
|
|
|
|
Re: The most useless key on my keyboard is:
by liverpole (Monsignor) on Nov 16, 2005 at 21:42 UTC
|
Although I voted for "Caps Lock (always leave it off)", what actually happens is -- I get so tired of accidentally hitting it once in a while, that I finally disable it on all computers I use (Linux and Windows both). If I ever need to do all caps (and I can't remember the last time I did!), I just hold down the shift key with whichever little finger I'm not using.
So for me it's actually a "worst than useless" key, it's the only one I have to expend an effort to disable!
| [reply] |
|
|
Actually I voted for F12. But Caps Lock is a good candidate, too. Whenever I sit at a system, where never worked on before, I change the system configuration from "Switch off Caps Lock by Caps Lock Key" to "Switch off Caps Lock by Caps Key".
So, diabling Caps Lock is not that effort any more.
| [reply] |
|
|
I am not sure why people dislike the caps lock key unless they are just used to never writing things to other people. Occasionally you need a heading or a title that is in all caps and anything over around 3 letters it is typically quicker to hit caps lock type it out then unlock it.
| [reply] |
|
|
LOL! AntiCapsLock ! transform, remove, etc - linux,windows,kde,novell,clipcontrol
| [reply] |
Re: The most useless key on my keyboard is:
by neniro (Priest) on Nov 16, 2005 at 21:47 UTC
|
All kind of 'multimedia'-keys on keyboards, or unreachable mouse-button number 4 or 5. | [reply] |
Re: The most useless key on my keyboard is:
by BrowserUk (Patriarch) on Nov 16, 2005 at 18:18 UTC
|
I had to vote for the "Windows" key (keys on my keyboard), but not for the reason specified.
I just have never worked out what it (they) are meant to do? They don't appear to do anything in any of the apps I use.
The contextmenu key is useful though.
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
Lingua non convalesco, consenesco et abolesco. -- Rule 1 has a caveat! -- Who broke the cabal?
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.
| [reply] |
|
|
They don't appear to do anything in any of the apps I use.
Exactly. This leaves it free as a modifier for custom mapping. Under Windows, there are some defaults (Win-L locks the display, Win-D shows the desktop, etc.), and there are third-party apps that let you map it to do more. I use one called WinKey (which isn't made anymore, sadly). When I want my browser up, Win-W. Win-P begins an Eclipse/EPIC session with a blank .pl file. And so on.
In Linux and BSD, they key is assignable to window-manager tasks (as the modifier 'Hyper' in most cases). On my linux devel box, Win-D starts my development environment (Eclipse/EPIC, Devel::ptkdb, and a couple other tools).
On the Mac, it's basically the PC world's "control" key, so almost all apps use it.
But, on any PC-based platform (damn it, I can't say 'x86-based' anymore!), it's one of the most useful keys because you can make it do whatever you want.
ScrollLock, though... what a pointless key. (Keyboard holy war! Yay!)
| [reply] |
|
|
ScrollLock, though... what a pointless key.
I do use scrolllock. Not because it does something in an application - but because I've some hardware that uses it: my switchbox. <<ScrollLock>><<ScrollLock>><<Page-Up>> goes to the next active computer, <<ScrollLock>><<ScrollLock>><<Page-Down>> goes to the previous active computer. There are a few more commands using scrolllock, but I can never remember them.
| [reply] [d/l] [select] |
|
|
| [reply] |
|
|
|
|
|
|
Well, I've binded "Windows" key both in flux and blackbox to run different applications. It's quite useful, because most of apps I use already make use from Ctrl wich I've replaced with CapsLock and Alt.
| [reply] |
|
|
Scroll lock was useful in the old days; No mouse.
| [reply] |
Re: The most useless key on my keyboard is:
by jonnybe (Scribe) on Nov 16, 2005 at 18:47 UTC
|
I don't know about demons as I havn't played Quake in years, but in Vim, ctrl-[ is just so much easier to reach! | [reply] |
Re: The most useless key on my keyboard is:
by Mago (Parson) on Nov 16, 2005 at 19:36 UTC
|
I vote for the "Windows" key, the unlike key and proprietary logo $$$ !!!
| [reply] |
Re: The most useless key on my keyboard is:
by Happy-the-monk (Canon) on Nov 16, 2005 at 22:24 UTC
|
((Å))
It supposedly toggles the WiFi network thingy, but I've got a cable plugged in, so what good is it?
And then there's the "power off" key.
But I never power off! Why would I?
Cheers, Sören
| [reply] |
|
|
| [reply] |
|
|
And then there's the "power off" key.
But I never power off! Why would I?
Um, apparently you don't live in a place with thunderstorms and tornados. During the summer, I usually have to shut down at least once a month because of serious lightning ... not that lightning is never serious, but when nighttime is like daylight because of the constant flashes, my computers get shut down and unplugged.
--
tbone1, YAPS (Yet Another Perl Schlub)
And remember, if he succeeds, so what.
- Chick McGee
| [reply] |
|
|
Er, why don't you get a ups/surge protector?
| [reply] |
|
|
|
|
|
|
|
|
| [reply] |
|
|
Re: The most useless key on my keyboard is:
by gaal (Parson) on Nov 17, 2005 at 07:36 UTC
|
Thispollismissingthespacebar! | [reply] |
Re: The most useless key on my keyboard is:
by ambrus (Abbot) on Nov 16, 2005 at 22:03 UTC
|
It's F5, F6, F8, F9, F10, F11 definitely. I never use the F-keys for anything except changing terminals, and I use only four text terminals, one graphical, and an error console. (Update: just realized that VNC uses F8.)
Pause is also mostly useless but a few games recognize it.
The SysRq magic is useful. Scroll Lock is sometimes useful to stop text (also it's the way to view the scrollback of the terminal on FreeBSD by default).
I definitely use Caps Lock. Its original purpose is not only useless but even harmful, as I press it accidentally too often. Thus, I've remapped it to write accented letters: it's easy because it's not too far to reach and I can hold it with my left hand while I type the accented letters with my right. It now works like this both on console and X.
I use Backspace, Escape, and # too.
Finally, I don't have a Windows key. I use a 101-button keyboard with no extra buttons on principle.
What's left? Ah, Mac key. I don't have one. Last time I had it was when I used a Commodore 64, although they called it the Commodore key there.
| [reply] |
|
|
Hello,
I definitely use Caps Lock. Its original purpose is not only useless but even harmful, as I press it accidentally too often. Thus, I've remapped it to write accented letters: it's easy because it's not too far to reach and I can hold it with my left hand while I type the accented letters with my right. It now works like this both on console and X.
I'm curious to know how you did to map your capslock key to do that, could you point me to revelent infos or tell me what to do to get that behaviour too?
Thanks.
| [reply] |
|
|
On the linux console, the loadkeys program loads a keymap. This program is part of the kbd package, and is usually invoked from an init script. Its input is a readable text file, which you can probably find if you follow the init scripts. You can also dump the keymap in this format with the dumpkeys utility.
On my Gentoo system, the keymaps are in the /usr/share/keymaps, and the default keymap is given in the /etc/rc.conf file. I've set this to my keymap which I've made by changing and existing keymap (this modified keymap predates my Gentoo system though, I have it from the time I've been using SuSE).
Here I include some relevant parts from the keymap file.
The trickyer part is to get the keys right under X. I didn't do this part all alone, rather, I copied the configuration from a good friend and only done a couple of modifications on it. This configuration program loads a keymap with the xmodmap program (which should be on your system if you have X). I start this configuration program from my .xinitrc file so that it would start on every X session (depending on the X login manager, you may need to use a different file for this).
I show some parts of this configuration too.
(There are some other tricky details needed to set up X correctly to use national characters, but they aren't quite relevant to the caps-lock hack, so I won't show them here.)
For further information, see the manpages of the above mentioned utilities, and also
http://www.inf.bme.hu/~pts/pts-console-hu-latest.tar.gz;
http://www.madore.org/~david/linux/.
If anyone needs them, I can upload a copy of the exact config files I use.
| [reply] [d/l] [select] |
|
|
Re: The most useless key on my keyboard is:
by kalle (Friar) on Nov 16, 2005 at 22:51 UTC
|
Don't think I've every used the Pause/Break key. So that gets my vote. I use Prt Sc sometimes, what's Sys Rq do? I'm guessing it stands for System Request, or some such.
I miss the Amiga keys. If someone makes a laptop with Amiga keys instead of the Win ones (and without those bloody useless "multimedia" buttons), I'm trading mine in. | [reply] |
Re: The most useless key on my keyboard is:
by QM (Parson) on Nov 17, 2005 at 04:05 UTC
|
Even less than Scroll Lock is Num Lock -- it's always on, or I figure out how to turn it on from boot. Sometimes, about once a year, I use the Scroll Lock key. The Windows "menu" key would be the least used, but sometimes I hit it by accident.
-QM
--
Quantum Mechanics: The dreams stuff is made of
| [reply] [d/l] |
|
|
I use all the keys listed, more or less, except the "Mac" key as my IBM laptop lacks one. I voted for "F12" before i remembered that that, when combined w/ "Shift", is "fvwm reload" key.
Given the miserable choices, I should have actually voted for the "Pause|Break", which i haven't used much in a while. On the third thought, vote should have gone to "Mac" key (as i did press "Pause|Break" w/ in last 5-6 years to cause FreeBSD kernel debugger to load (for kicks of course)).
I am highly surprised that there is no "NumLock" option; that's a rather useless key on a small|cramped keyboard (where numbers are overlayed on the staggered letters).
| [reply] |
|
|
Reminds me...The most *useful* key on the Sun keyboard was *STOP*, as in <Stop-A>. We had some crappy applications, plus the network idiots^Wmagicians should have changed places with the janitor.
-QM
--
Quantum Mechanics: The dreams stuff is made of
| [reply] |
Re: The most useless key on my keyboard is:
by b10m (Vicar) on Nov 16, 2005 at 21:15 UTC
|
Yuck, what a hard poll. The Mac key I (unfortunately) don't have, so that leaves me with one option less. The Windows keys I don't have (yet; old keyboard), but if I had it, I'd probably map it to something useful (why is it useless to Linux people???). The Esc key I use too much. Caps lock I sometimes use as Shift, when the Shift key is broken again....
I think I'll go for the Backspace button. Just have to get used (more) to the Readline vi Mode.
--
b10m
All code is usually tested, but rarely trusted.
| [reply] |
|
|
The "windows key" just sends the code for control-escape. So, whether it's actually on your keyboard or not, you arguably could still map it to something useful...
-Scott
| [reply] |
|
|
| [reply] |
|
|
Re: The most useless key on my keyboard is:
by Joost (Canon) on Nov 16, 2005 at 20:36 UTC
|
It used to be capslock, but my debian system's XF86Config file now includes the following line:
Option "XkbOptions" "ctrl:nocaps" #disable capslock -
+> make ctrl
Also, I DO use the windows key for my window manager (Ion3), and for some reason the "other" windows key (the "menu" key) works for selecting drop-down menus but it's probably the only key I never use.
| [reply] [d/l] |
Re: The most useless key on my keyboard is:
by KPeter0314 (Deacon) on Nov 17, 2005 at 17:22 UTC
|
Scroll Lock! I mean, when was the last time you emulated a dumb terminal on your PC and actually needed to use the Scroll Lock to stop scrolling?
I used to work in an office where everybody had a terminal and only the gifted had PCs. Back then you actually needed a Scroll Lock when looking at some reports that would go on for pages and pages. Why it didn't die and actually followed onto the PC keyboard is a mystery to me.
An actual vote for how useless it is should be recorded by the manufacturers of KVM switches that use that key to activate the switch. If it is useless enough for them to hijack it, then it is really useless!
| [reply] |
Caps Lock
by antitrust (Initiate) on Nov 17, 2005 at 12:02 UTC
|
I voted for Caps Lock, because it is not simply "useless" (as weirdos: pause, Scrlk, PrtScr) it is harmful! I wish this key were never invented!!! It was useless even on conventional typewriters. | [reply] |
|
|
Harmful? Just remap it. I use it as an alternative control key:
xmodmap -e 'add Control = Caps_Lock'
Why control? Because I used to use keyboards where the CapsLock key was below the shift key. Quite useful for me in those days to have the above mapping - on a standard PC keyboard, I seldomly use the CapsLock key - but if I hit it by accident, it won't cause SHOUTING.
| [reply] [d/l] |
|
|
That's because you don't have RSI.
| [reply] |
The most useless key on my keyboard is Num Lock
by jonadab (Parson) on Nov 17, 2005 at 12:16 UTC
|
Why on earth would I want Num Lock *ever* to be on? There's already a perfectly good set of numbers, right above where the letters are, so *why* would I want to use the cursor control keypad for typing numbers? I need those keys for their original intended purpose. (No, don't talk to me about the duplicate keys that were added for the 101-key layout; they're arranged very badly, so that you can't reach both the arrows and pgup/pgdn/home/end without moving your hand; on the keypad, you can do it all.)
Since Num Lock wasn't an option, I voted for Caps Lock, although it's really quite a bit more useful since there is usually an option to treat it as another Ctrl key, which gives you one that's slightly easier to reach.
| [reply] |
|
|
You've never done sales or done a great deal of straight numeric entry.
Besides just being faster in normal use, when one is trying to sort out papers with one hand and quick-typing numbers with the other, there is no replacement for the 10-key (Well, on my keyboard 18-key) numeric keypad.
| [reply] |
|
|
You've never done sales or done a great deal of straight numeric entry.
I'm a programmer, Jim, not an accountant.
Besides just being faster in normal use
That's just the thing -- typing the numbers on the top row is faster (assuming you actually type rather than hunt and peck). Typing "7" takes the same amount of time as typing "b"; typing "$" takes the same amount of time as typing "M". Typing "1,241,760" takes the same just about amount of time as typing "keyboards".
I could see it if you were re-typing long columns of numbers, like accountants used to have to do when they were entering data that came to them on paper, but I was under the distinct impression that such primitive times were just about over now, and that each number was now put in just once, when the purchase order line items are initially filled in, and that subsequent operations (such as removing the money from the fund, printing the number on the check, listing expenditures on the budget report, and so forth) would be handled automatically by the accounting software. I realise that accounting software is 15 years behind word processing software in terms of standardization, featurefulness, and user interface, but nevertheless, typing things twice was done away in the late 70s for computer geeks and in the late 80s for everyone else, so it ought to be thoroughly gone now for accountants as well, I should hope. Do they really have to re-type in long columns of pre-existing numbers? Ugh.
| [reply] |
|
|
|
|
Re: The most useless key on my keyboard is:
by Aristotle (Chancellor) on Nov 18, 2005 at 04:51 UTC
|
| [reply] |
Re: The most useless key on my keyboard is:
by Subliminal Kid (Initiate) on Nov 18, 2005 at 12:00 UTC
|
PrtSc/Sys Req: I do very very rarely use this key, much more on *nix than Winboxen because it puts an image in a folder rather than that clipboard stuff.
Scroll Lock: I'm going to have to go with this. I just don't tail fast moving logs often enough to get excited about it.
Caps Lock (always leave it off): In fact IO quite often have to pull this key off (why it is so out sized on some keyboards I have no idea but my typing isn't all that aND THIS EFFECT normally follows at some point)
Pause/Break: I still use this, mainly when trying to get out of windowsNT batch files (written for places that I can't deploy activeperl or anything else for that mater)
The 'Windows' key (because I run Linux): My Windows key works in Linux! There is a fix for it <google> and I've got a small penguin sticker.
The 'Mac' key (same reason): I have no such key <shrug>
# (comments are for sissies): Use POD or something - what do you do when the semi-colon key breaks?
F12 (hard enough to remember what F1 does): Someone has already said you need this key to access a Dell BIOS; I don't have a Dell but everyone else on the sodding planet seems to.
Esc (I prefer to face my demons head on): I use vim, you can't have my Esc key :qw.
Backspace (I never make mistakes): How would I fix the mistakes I make with the cAPSLOCK key without this one?
BUT what is Alt Gr for?
| [reply] |
|
|
If you use vim you should seriously consider mapping the Caps Lock key to Escape. Then they can have your (other) Esc key, since after two days with some discipline you will never touch it again - The only problem with this is all the CAPITAL letters you get when doing stuff using VIM on someone elses computer.
| [reply] |
|
|
This sounds a nice idea. I always thought escape was a bit too far to press.
I won't use it for two reasons. Firstly I've used up Caps Lock for a much better purpose, see my reply to this poll. Secondly, I don't use vi*, so I use escape much less frequently during editing and those times it's always a modifier, so I can just use the Alt key (either of them, I don't make this riddiculous distinction between Green Alt and Alt Gr).
Other then these, I agree with your idea.
Finally let me note that a friend of mine uses vim and has remapped the two-character sequence ;x to escape in it, as it almost never appears in text and is easy to type. That has the advantage over your method that he doesn't have to install any special software to change the keyboard settings, as the mapping is done by vim itself. Also this way he doesn't have to find out how to do the remapping on every system separately (like X, Linux console, OS X, Windows etc). I had to experiment much to make the same sane keyboard settings work both on the Linux console and X.
| [reply] [d/l] |
|
|
I've actually mapped CTRL to the Caps-Lock key, resulting in a Sun-like layout. But mapping the actual CTRL-key to ESC is an idea I haven't had before.. Thanks :)
Regards,
-octo
| [reply] |
french colonial
by mojotoad (Monsignor) on Nov 17, 2005 at 07:57 UTC
|
Not an entry in the poll, but man I hate the keyboards that show up in ex-French colonies such as Morocco and various locales in Southeast Asia. The keys are 'mostly' in place except for an annoyingly few exceptions -- I'd rather it be totally mangled rather than just 'here and there'.
Matt
Update: well, I initially misread the poll, so perhaps I should add that my answer is 'those annoying keys on french colonial keyboards' ... at first I thought the poll was about keyboards rather than keys. :) | [reply] |
Re: The most useless key on my keyboard is:
by marto (Cardinal) on Nov 17, 2005 at 12:40 UTC
|
We should all get one of these keyboards :)
Martin | [reply] |
Re: The most useless key on my keyboard is:
by tbone1 (Monsignor) on Nov 17, 2005 at 13:53 UTC
|
I had to choose "Windows Key" because I use a Mac at home and, at work, never touch it except by accident.
However, I use the function keys a lot. In OS X, they are part of Expose', which is one of those "how in the heck did I ever live without this" utilities. Also, at work, we use them on Oracle forms and F12 is a shortcut back to the main menu.
(Reads what he's written.) Man, that is so self-absorbed that I think I need to move to Hollywood.
--
tbone1, YAPS (Yet Another Perl Schlub)
And remember, if he succeeds, so what.
- Chick McGee
| [reply] |
Missing option Re: The most useless key on my keyboard is:
by BerntB (Deacon) on Nov 17, 2005 at 00:48 UTC
|
The most useless key must be one I've never found, but use RETURN for instead when documenation asks for it -- the Any key,
| [reply] |
Re: The most useless key on my keyboard is:
by blazar (Canon) on Nov 17, 2005 at 11:32 UTC
|
The 'Windows' key (because I run Linux)
The 'Windows' key (because I don't have it - but if I had it wouldn't use it!).
On a second thought if I had it, then I would either switch back to a keyboard that doesn't have it. Or extirpate it!!
Oh, and before someone points out that "since I don't have it it can't be the most useless one", I'll say that quite on the contrary, any element of the empty set, just because of its emptiness does have any property you want. In particular, being the set of 'Windows' keys on my keyboard empty, all of its elements are the most useless keys. And the most useful, d'oh! For some reason I tend to concentrate on the former...
| [reply] |
|
|
This is the most ridiculous reasoning I've seen today.
And I'm on teh Internet.
| [reply] |
|
|
- However ridicule it may be, it's mathematical* resoning, perfectly consistent,
- ever heard 'bout humor, irony, or light sarcasm?
* For more details ask the knowledgeable people (and the crackpots!) at sci.math...
| [reply] |
Re: The most useless key on my keyboard is:
by mikeock (Hermit) on Nov 17, 2005 at 01:13 UTC
|
Wish more than anything that it was this darn function (Fn) key on my laptop... But no... | [reply] |
Re: The most useless key on my keyboard is:
by blackmateria (Chaplain) on Nov 21, 2005 at 14:56 UTC
|
I had to vote for "SysRq," since not only have I never pressed it, but I've never had any idea what it was for, ever since I first saw one in 1987. Although, I do use "Print Scrn," which is on the same physical key, to take screenshots under Windows pretty often.
I'm surprised that nobody has mentioned the "Application" key (the one with a little picture of a drop-down menu and a cursor) on Windows keyboards. Surely that is more useless than the Windows logo key, which allows Win+R, Win+L ("Lock Workstation" on Windows XP), etc. I know it's supposed to bring up a context menu, but it's easier for me to just press Shift+F10. I guess I could remap it to something else, like I already did with Ctrl/Caps Lock and Esc/~ for Vim.
| [reply] |
|
|
The Linux kernel has a compile-time option called "The Magic SysRq key" that makes SysRq actually do what it sounds like - request certain functions directly from the "system" (which is the kernel in this case).
For example:
- Alt-SysRq-S asks the kernel to sync all filesystems.
- Alt-SysRq-U unmounts all filesystems (actually, remounts them all readonly)
- Alt-SysRq-B reboots the system immediately
Many vendor-compiled kernels have the compile-time flag on, but disabled at runtime via /proc/sys. Re-enable it with "echo 1 > /proc/sys/kernel/sysrq", or put "kernel.sysrq = 1" in /etc/sysctl.conf.
Alt-SysRq-S,U,B (hold down the Alt-SysRq while you sequence through S, U, B) is a safe reboot with no fileystem damage, in cases where the system appears to be locked up, but the kernel is in fact still alive enough to see your SysRq requests.
See here: Linux Sysrq docs for more details and all of the other sysrq functions available.
| [reply] [d/l] [select] |
Re: The most useless key on my keyboard is:
by Knom (Beadle) on Nov 30, 2005 at 08:28 UTC
|
| [reply] |
Re: The most useless key on my keyboard is:
by jimbus (Friar) on Nov 17, 2005 at 18:35 UTC
|
I would have voted for the windows key, if there had been, "I use Windoze the that key is still worthless!"
| [reply] |
Re: The most useless key on my keyboard is:
by japhy (Canon) on Nov 18, 2005 at 05:51 UTC
|
I don't know about you, but I never touch half the keys on my APL keyboard.
| [reply] |
Re: The most useless key on my keyboard is:
by blue_cowdawg (Monsignor) on Nov 17, 2005 at 00:47 UTC
|
I'm not sure this qualifies as a "key" but lately
the key that I'm "pressing" the most is the flat
spot on either side of the pointer tablet on my laptop.
Hitting it sharply is a better word for it.
You see, the video on my IBM T30 keeps cutting out on me
while I type, so I'm forced to smack it with my fists every
once in a while so I can see what I'm typing.
I get a sad, sick, tactile satisfaction out of smacking
the blasted thing......
| [reply] |
Re: The most useless key on my keyboard is:
by sub_chick (Hermit) on Nov 26, 2005 at 05:59 UTC
|
well, i see no use for the start menu button in the top right hand corner of my keyboard...does nothing i can't do by clinking my mouse. | [reply] |
Re: The most useless key on my keyboard is:
by liverpole (Monsignor) on Dec 06, 2005 at 14:22 UTC
|
For anyone who's interested, here's a script which will disable the Caps Lock key under Linux, or turn it back on. The default is to apply it only to the current user; to make the change global, the -g switch is used.
#!/usr/bin/perl -w
#
# Disable/Enable the caps lock key
# 051206 liverpole
#
##############
### Strict ###
##############
use strict;
use warnings;
####################
### User-defined ###
####################
my $xmodmap = '/usr/bin/X11/xmodmap';
my $sysmodmap = '/etc/X11/Xmodmap';
my $usrmodmap = $ENV{'HOME'} . "/.Xmodmap";
#################
### Libraries ###
#################
use FileHandle;
use File::Basename;
use Getopt::Long;
###############
### Globals ###
###############
my $iam = basename $0;
my $b_global = 0;
my $syntax = "
syntax: $iam [switches] <'off' | 'on'>
Disables or reenables the CAPS LOCK key by changing the appropriat
+e
'Xmodmap' file. Use 'off' to disable, and 'on' to reenable.
Switches: -g ... apply the change globally (must be run as 'root'
+)
";
####################
### Command-line ###
####################
GetOptions("g" => \$b_global) or die $syntax;
(my $state = shift) or die $syntax;
if ($state ne 'off' && $state ne 'on') {
die "$iam: invalid state '$state' (should be 'off' or 'on')\n";
}
###################
### Subroutines ###
###################
sub perform($) { my ($cmd) = @_; print "% $cmd\n"; system($cmd) }
####################
### Main program ###
####################
# If making global changes, make sure user is 'root'
if ($b_global) {
(0 == $<) or die "$iam: you must run this as 'root'\n";
}
# Read the appropriate file
my $infile = ($b_global || (!-e $usrmodmap))? $sysmodmap: $usrmodmap;
my $fh = new FileHandle;
open($fh, "<", $infile) or die "$iam: cannot read '$infile' ($!)\n";
chomp(my @lines = <$fh>);
close $fh;
printf "Read '$infile' -- %d line%s\n", 0 + @lines, (1 == @lines)? "":
+ "s";
# Modify the file
@lines = grep { !/^\s*(remove|add)\s+Lock\s+=\s+Caps_Lock\s*(!|$)/i }
+@lines;
($state eq 'off') and push @lines, "remove Lock = Caps_Lock";
($state eq 'on') and push @lines, "add Lock = Caps_Lock";
# Write the file
my $outfile = $b_global? $sysmodmap: $usrmodmap;
open($fh, ">", $outfile) or die "$iam: cannot write '$outfile' ($!)\n
+";
map { print $fh "$_\n" } @lines;
printf "Wrote '$outfile' -- %d line%s\n", 0 + @lines, (1 == @lines)? "
+": "s";
close $fh;
# Make the changes take effect
if (-x $xmodmap) {
(-f $sysmodmap) and perform "$xmodmap $sysmodmap";
(-f $usrmodmap) and perform "$xmodmap $usrmodmap";
}
@ARGV=split//,"/:L";
map{print substr crypt($_,ord pop),2,3}qw"PerlyouC READPIPE provides"
| [reply] [d/l] |
Re: The most useless key on my keyboard is:
by ciderpunx (Vicar) on Nov 18, 2005 at 11:08 UTC
|
Well, I don't know about all these keys being useless, someone always seems to come up with a reason for their existence!
Anyhow, here's my most useful key (for when programs ask me to 'press any key').
| [reply] |
Re: The most useless key on my keyboard is:
by johnnywang (Priest) on Dec 02, 2005 at 05:56 UTC
|
Why isn't "$" on the list? I pound on it daily, but no money comes out of it: the ultimate useless key. | [reply] |
Re: The most useless key on my keyboard is:
by Smonff (Monk) on Mar 04, 2021 at 19:26 UTC
|
Really hate that plane mode key that disable the WiFi. On my work HP, you hit this without even using the Fn key. Each time, I try to reach it as the plain F11 key (usually for fullscreening applications) and I end up with no network, VPN disconnection and more SSH sessions dead. Who wants no network anyway?
| [reply] |
Re: The most useless key on my keyboard is:
by kirbyk (Friar) on Nov 24, 2005 at 00:10 UTC
|
I don't have most of these keys. However, I use my Commodore Key all the time! C-64 forever!
| [reply] |
Re: The most useless key on my keyboard is:
by TomDLux (Vicar) on Nov 25, 2005 at 18:08 UTC
|
I pry off and discard the Caps Lock key from my keyboards. That way I don't have to worry about accidentally pressing it and not noticing that I'm typing everything in upper case.
--
TTTATCGGTCGTTATATAGATGTTTGCA
| [reply] |
Re: The most useless key on my keyboard is:
by Moron (Curate) on Nov 28, 2005 at 15:26 UTC
|
Reminds me of an announcement I heard that Microsoft were releasing a new superlite PDA - it's smallness being assisted by making do with only three keys ... ctrl alt and delete ;) | [reply] |
Re: The most useless key on my keyboard is:
by gu (Beadle) on Nov 29, 2005 at 16:49 UTC
|
Some of them are very useful, or can be turned to usefulness :)
PrtSc/Sys Req : kernel-level keyboard shortcuts
Caps Lock : remapped to Tab
The 'Windows' key : launch xterm
F12 : tty12 is the place for logs !
Esc : a Vim addict as I am can't live without this one !
Gu | [reply] |
Re: The most useless key on my keyboard is:
by EvanK (Chaplain) on Nov 29, 2005 at 22:22 UTC
|
what about Insert? not only is it useless, it's dangerously close to delete and home, so I'm ALWAYS accidentally hitting it.
to make matters worse, i tend to type sometimes without looking up at the screen, so I'll be typing 3 paragraphs before i look up and find half my document gone! curse the Insert key!
__________ Build a man a fire, and he'll be warm for a day. Set a man on fire, and he'll be warm for the rest of his life.
- Terry Pratchett
| [reply] |
Re: The most useless key on my keyboard is:
by fireartist (Chaplain) on Dec 03, 2005 at 23:21 UTC
|
The most useless keys on my mac keyboard are volume up, volume down and volume mute.
I don't think I've ever remembered to use them.
| [reply] |
Re: The most useless key on my keyboard is:
by hoppfrosch (Scribe) on Nov 21, 2005 at 08:15 UTC
|
Since I use a keyboard remapping tool I don't have any useless keys anymore.
But in former days the most annoying key was "Caps Lock" - since I was used to recognize the Caps Lock only after half day of hard work ...
Therefore my advice: have a look to screen while typing ... ;-) | [reply] |
UK keyboard answer
by PhilHibbs (Hermit) on Nov 29, 2005 at 17:46 UTC
|
There's a key in the top-left, next to the 1, that has three symbols on it, ` ¬ and |, and I don't know how to make it procude a |. I don't use ` and as to what a ¬ is, I have no idea. The only time I've ever pressed it is to see what it does. UK keyboard Oh, hang on, I do use ` occasionally if I'm using a unix shell, so maybe it is useful, but not to a Windows-type like me. | [reply] |
|
|
Alt-gr (the right-hand Alt key) + that key will produce the "broken-bar" symbol '¦'.
'¬' is known in some circles, predominantly the APL crowd as the 'not' symbol. It can also be used as not in REXX if a ¬= 'this' then if memory serves.
As for '`', I've often wished that the back-ticks use of this could be relinguished in favour of qx[] so that it could then be utilised for something else.
Eg. some of the inconsistancies with {} being interpreted as anonymous hashes instead of blocks could be done away with if a hash used backticks. $hash`key`. It would also do away with the need for double delimiters where the key contains spaces and other similar characters: $hash{'another key'} or
$hashref = `key1 => value1, key2 => value2`;
Though it would require both '`' and '=' to be escaped if part of a key.
Perl 6 has gone for %hash<<key>>, which for is okay, but still requires "double delimiters" for non-unicode typing or at least double keystrokes for those set up for unicode compositing.
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
Lingua non convalesco, consenesco et abolesco. -- Rule 1 has a caveat! -- Who broke the cabal?
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.
| [reply] [d/l] [select] |
Re: The most useless key on my keyboard is:
by exussum0 (Vicar) on Dec 06, 2005 at 15:49 UTC
|
'least you have a windows key. Damned T42 doesn't have one and I had to learn ctrl-escape. And don't get me started about num lock and using the number keys. Shift-numlock, then hold down alt, 1-3-0, shift numlock. All for one é.
You kids have no clue how good you got it. :) | [reply] |
Re: The most useless key on my keyboard is:
by stevieb (Canon) on Mar 04, 2021 at 19:57 UTC
|
The Delete key.
It's broken, so it's quite literally useless.
| [reply] |
Re: The most useless key on my keyboard is:
by Anonymous Monk on Mar 04, 2021 at 14:44 UTC
|
I have never used Caps-Lock, in my opinion, it's useless | [reply] |
Re: The most useless key on my keyboard is:
by filibi (Initiate) on Apr 07, 2009 at 19:21 UTC
|
I think you should make one of the answers "all of the keys" are totally a waist of space on my keyboard, because they really are. At least on my keyboard they are! It has everything from: user,hp,?,photo,music,video,shopping,sports,finance,connect,search
chat,email.... I mean is there actually a way to set these
to actually go where you want them to go because I can almost guarantee they wont be going where you want them to go,lol.
chow 4 now - ya'll have a good day... | [reply] |
|
|
I use all of the keys ;)
The F keys are all used for something, PrintScreen/SysRq are used for screenshots and getting out of a crashed kernel respectively, Scroll lock is for locking the scroll in a VT (or Excel but don't go there), Pause/Break is often used for pausing in games (and is used to get out of a crashed Acorn computer ;))
I've mapped Winkey to compose (anyone who hasn't, I'd do that now and learn how to use it - if you ever need to type in a foreign language or use odd symbols, you won't regret it!)
The rest go without saying...
| [reply] |
Re: The most useless key on my keyboard is:
by Anonymous Monk on Nov 05, 2012 at 08:24 UTC
|
I think the most useless key on my keyboard is the "." on the NumPad :| | [reply] |