Select Code to Download

>I
CATCAGTATAAAATGACTAGTAGCTAGATACCACAGATACGATACAACA
>II
TACCACAGATACGATACAACACATCAGTATAAAATGACTAGTAGCAGAC

I    2    A    G
I    4    C    T
I    5    A    G
...
II    5    A    C
II    8    G    T
II    10    T    G

$F0 = DNA sequence the changes should be made to
$F1 = Letter position that is involved in the change
$F2 = Pre-existing letter
$F3 = Replacement letter

#!/usr/bin/env perl
use strict;
use warnings;
...
    print OUT ">$key\n$value" if $iteration=~1;
    print OUT "\n>$key\n$value" if $iteration>1;
}

substr($value,$F[1]-1,1) = $F[3];
use 'next' instead of 'last'
added seek(IN,0,0);