Help for this page

Select Code to Download


  1. or download this
    # ----- prediction on sequence number 3 (length = 713, name = seq_03) 
    +-----
    #
    ...
    # Predicted genes for sequence number 3 on both strands
    # start gene g4 ....
    [as same as above]......so on and on...
    
  2. or download this
    #!/usr/local/bin/perl
    
    ...
    for(my $i=0;$i<$#new_array;$i++){
            print "$i-$new_array[$i]\n";         #preparing for further pr
    +ocessing
            }
    
  3. or download this
    0- ----- prediction on sequence number 1 (length = 105, name = seq_01)
    + --
    1- start gene g1
    ...
    18- tttgagaccttcaatcctgaggcgtgagacgcagtctggaggagcagctc]
    19- protein sequence = [LRRETQSGGAALCSLFDPPPTPTACAHANSP]