User since: Oct 14, 2001 at 04:09 UTC (24 years ago)
Last here: Jun 25, 2004 at 19:10 UTC (21 years ago)
Experience: 172
Level:Beadle (5)
Writeups: 19
Location:n/a
User's localtime: Dec 19, 2025 at 01:10 UTC
Scratchpad: None.
For this user:Search nodes

The first sequence is the cds sequence and the second is the ffn seque +nce. The output is below this and you will notice that the last "int +ron" at right edge (3 prime end) does not get printed out. i.e. AAAA +AAAA does not get printed out. I realize now that this is something +I did not specify.
[download]
>1 ...(cds sequence) ATGGGGGTCTCTCTCTCTCTCGTCTCTCATCTCT
[download]
>1 ...(ffn sequence) AAAAAATGGGGGTCTCTCTCTCTCTCGGGGGTCTCTCATCTCTAAAAAAAA
[download]
Output: (I tinkered with the output the way I need it) >1 {ATGGGGGTCTCTCTCTCTCTC} is preceeded by AAAAA >1 {GTCTCTCATCTCT} is preceeded by GGGG I am not sure if this is an easy thing to fix...I don't like to take u +p too much of your time...if this is too much to fix I understand and + I appreciate what you have done thus far. Dr.J
[download]