Ya, here is a BioPerl solution to interleave to sequences:

#!/usr/bin/env perl
use strict;
use warnings;
use Bio::SeqIO;

my $fasta_in_1 = $ARGV[0];
my $fasta_in_2 = $ARGV[1];
my $fasta_out  = ">interleave_1_2.fa";

my $seqio_in_1 = Bio::SeqIO->new(
    -file   => $fasta_in_1,
    -format => 'Fasta',
);

my $seqio_in_2 = Bio::SeqIO->new(
    -file   => $fasta_in_2,
    -format => 'Fasta',
);

my $seqio_out = Bio::SeqIO->new(
    -file   => $fasta_out,
    -format => 'Fasta',
);

while ( my $seq_obj_1 = $seqio_in_1->next_seq() ) {
    my $seq_obj_2 = $seqio_in_2->next_seq();
    $seqio_out->write_seq($seq_obj_1);
    $seqio_out->write_seq($seq_obj_2);
}
__END__
>qppq
ATATATTTATTATTATATATATTATATTATTA
>dfj
TATTATTATTTTATAT
>lsl
ATTATTATTATTATTAGGAGGAG
>ghg
ATATATAT
[download]

However, I'm not entirely sure of the best way to delimit the pairs with ============ using this approach.

You're essentially taking an entry from each file at a time, but you could do this by reading each file into an array, and unshifting an entry off each array as d1 and d2 and then doing:

print <<EOF;
$d1
$d2
========
EOF
[download]

Nice pun!

For anyone that doesn't know, FASTA format is a flat-file way to store any number of DNA/RNA/protein sequences and each entry consists of (1) a sequence ID line that starts with a '>' character and (2) one or more lines containing the actual sequence.

use 5.014;
use strict;
use warnings;

my @f1 = qw(
  >qppq
  ATATATTTATTATTA
  TATATATTATATTAT
  TA
  >lsl
  ATTATTATTATTATT
  AGGAGGAG
  );

my @f2 = qw(
  >dfj
  TATTATTATTTT
  ATAT
  >ghg
  ATATATAT
  );

{
    my $i = 1;

    sub get_lines {
        my $array_ref = shift;
        $i = shift if @_;

        my $old = $i - 1;
        while (exists $array_ref->[$i]
               and chr ord $array_ref->[$i] ne '>') {
            $i++;
        }

        return splice($array_ref) if $#{$array_ref} <= $old;
        return splice($array_ref, $old, $i - $old);
    }

    while (@f1 && @f2) {
        my $j = $i;
        say join("\n", get_lines(\@f1, $j), get_lines(\@f2, $j));
        say "============";
    }
}
# TZN
[download]

In the contrary: it is working! Maybe not the way you expect, but you didn't tell what you expect, did you?

yeah it is working but the not according to the output file i have mentioned :(

Hi, viktor,
Please, reformat the output you desire, using the code tags.

If you tell me, I'll forget.
If you show me, I'll remember.
if you involve me, I'll understand.
--- Author unknown to me

#!/usr/bin/perl --
use strict; use warnings;

Main( @ARGV );
exit( 0 );

sub Main {
    @_ or die "\nUsage: $0 infile infile infile > outfile\n";

    my @files = map { open my( $fh ), '<', $_ or die $^E; $fh; } @_;

    while( my @ofh = grep not eof, @files ) {
        print getOne( shift @ofh ) while @ofh;
    }
} ## end sub Main

sub getOne {
    ...;
}

## perltidy -olq  -csc -csci=10 -cscl="sub : BEGIN END" -otr -opr -ce 
+-nibc -i=4 -pt=0   "-nsak=*"
[download]