Hi MBobur,
If I must add my voice to the wonderful wisdom, you have gotten before now.
Which would you rather prefer

• To follow both
  marto's wisdom in Re: intron length to one of your post,
  and that of
  blue_cowdawg which says:
  fellow monk, there are better ways to ask homework questions. First step in my opinion is to try and solve the problem yourself. If it works, you've accomplished something truly great. If it crashes, burns and dies in the flames then you'll accomplish even greater things by posting a well titled and formatted question to Seekers of Perl Wisdom so that others in a similar predicament as yours can learn by it. At least, in my honest opinion, is how Perl Monks is supposed to work.
• OR, I write this for you:

  use warnings;
  use strict;
  
  while (<DATA>) {
      print $1, $/ if m[^>(?=(.+?)\|)];
  }
  
  __DATA__
  >BTBSCRYR|IV|123123-43245273 tgcaccaaacatgtctaaagctggaaccaaaattactttct
  +ttgaagacaaaaaggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccg
  +ctg 
  >BTBSCRYADASR|IV|123123-43245273
  [download]

  And you have to keep asking, what which stand for and how to do the next assignment/ or project?

I think, you will grow and become a better Perl user, even helping others if you choose to follow the wisdom(s) of those who has walked your path before now.
However, if all these doesn't make sense then you can check this: How do I post a question effectively?