Entering the land of Perl

manbroski has asked for the wisdom of the Perl Monks concerning the following question:

Greetings, Monks.

In my weary travels, I have found a serene beauty in your language. It is sometimes harsh, but it is also beautiful. I come from the land of Python, were folks carry their language as a hammer, always clear and to the point. However, at times I wish that I can wield a rapier, swift and effective. Which is why I come to the Monastery.

Recently, I have started looking at problems on Rosalind (rosalind.org) and decided to solve all the tasks in Perl. Question number 1 is particularly interesting. It is simple, yet writing clean code for it may be a challenge. The task is simple - count letters in a string and print counts in alphabetical order.

Here is what I came up with

#!/usr/bin/env perl
#Question 1: Counting DNA nucleotides
use v5.16;

sub sort_and_print_hash_keys (\%) {
    my %hash = %{shift()};
    foreach (sort keys %hash) {
        print "$hash{$_} ";
    }
    print "\n";
}

sub counting {
    my %letters = ();

    chomp(my $seq = readline);

    foreach my $base (split //, $seq) {
        $letters{$base}++;
    }

    sort_and_print_hash_keys(%letters);
}

counting();
[download]

As you might see, I like clean and meaningful code. One thought per line.

My question is twofold. First, is this idiomatic Perl? Would you have done something differently? Please, critique this.

Second, I am wondering if the magic behind hash ref passing has any side effects. Here, I use a subroutine prototype declaration to ensure argument type safety and dereference immediately with %{shift()}. Are there any undesired consequences of this? Does any other code flatten out data structures or makes unnecessary copies? I am aware that 'sort keys' would create a separate array of keys.

Thank you, monks. I eagerly await your wisdom

Comment on Entering the land of Perl Download Code

Replies are listed 'Best First'.
Re: Entering the land of Perl by choroba (Cardinal) on Apr 04, 2013 at 21:38 UTC
Hello manbroski, welcome to the Monastery! Prototypes are seldom used in Perl. It is usually enough to pass a reference as the argument directly: `sort_and_print_hash_keys(\%letters);` [download] Moreover, counting characters in a string is idiomatically done via the `tr` operator. We know in advance that the possible characters are A, C, T and G only, so you can write: `#!/usr/bin/perl use strict; use warnings; use feature qw(say); my $s = shift; say join " ", map eval "$s =~ tr/$_//", qw/A C G T/;` [download] Which was exactly my solution to the DNA problem on Rosalind :-) لսႽ† ᥲᥒ⚪⟊Ⴙᘓᖇ Ꮅᘓᖇ⎱ Ⴙᥲ𝇋ƙᘓᖇ	[reply] [d/l] [select]
Re^2: Entering the land of Perl by manbroski (Initiate) on Apr 04, 2013 at 21:51 UTC
That, sir, is a beauty. Anything functional (in the map-reduce sense) makes me quite happy. You have my thanks. EDIT: what version is this? 5.16 'use strict' returns all zeros for each count. Does that provide the function return code?	[reply]
Re^3: Entering the land of Perl by choroba (Cardinal) on Apr 05, 2013 at 06:06 UTC
The shift requires the string as an argument of the script. If you want to read it from a file, you have to use `$s = <>;` [download] instead and provide the input file as the argument. لսႽ† ᥲᥒ⚪⟊Ⴙᘓᖇ Ꮅᘓᖇ⎱ Ⴙᥲ𝇋ƙᘓᖇ	[reply] [d/l]
Re: Entering the land of Perl by jwkrahn (Abbot) on Apr 04, 2013 at 23:30 UTC
Please, critique this. You say you want to "count letters in a string" but you are counting all characters. `$letters{$1}++ while $seq =~ /([[:alpha:]])/g;` [download] You shouldn't use prototypes. And besides you are just copying the contents of the hash anyway which you could do more simply as: `sub sort_and_print_hash_keys { my %hash = @_;` [download]	[reply] [d/l] [select]
Re^2: Entering the land of Perl by manbroski (Initiate) on Apr 04, 2013 at 23:52 UTC
Good call on the letters versus characters. But as far as the prototype passing, I was certain that it enforces a pass by reference. Notice that I have to dereference it after the passage. So the hope is that there is no copying.	[reply]
Re^3: Entering the land of Perl by 2teez (Vicar) on Apr 05, 2013 at 03:17 UTC
Hi manbroski, "..Notice that I have to dereference it after the passage.." Why is that? Did you also notice your subroutine sort_and_print_hash_keys definition `sub sort_and_print_hash_keys (\%) {..` [download] and how you eventually used the it like so: `sort_and_print_hash_keys(%letters); # you passed a hash variable not a + hash ref.` [download] ".. But as far as the prototype passing, I was certain that it enforces a pass by reference..." If I may suggest, you will do well yielding the wisdom of jwkrahn, as regard the usage of prototype for this reason: When you use a reference prototype, like "\$", "\@", "\%" `"...those symbols don't actually say that you must pass in a scalar reference, an array reference, and a hash reference. Rather, they say you must pass in a scalar variable, an array variable, and a hash variable. That means that the compiler insists upon seeing a properly notated variable of the given type, complete with "$", "@", or "%" in that slot. You must not use a backslash. The compiler silently supplies the backslash for you... "` from Far More than Everything You've Ever Wanted to Know about Prototypes in Perl -- by Tom Christiansen -- by liverpole, under subheading Problems with Reference Prototypes Hope this helps. If you tell me, I'll forget. If you show me, I'll remember. if you involve me, I'll understand. --- Author unknown to me	[reply] [d/l] [select]
Re^3: Entering the land of Perl by jwkrahn (Abbot) on Apr 05, 2013 at 14:37 UTC
Notice that I have to dereference it after the passage. So the hope is that there is no copying. In your code you have: `sub sort_and_print_hash_keys (\%) { my %hash = %{shift()}; foreach (sort keys %hash) { print "$hash{$_} "; } print "\n"; }` [download] Which is copying the entire hash. If you didn't want to copy the hash you could do it like this: `sub sort_and_print_hash_keys (\%) { my $hash = shift; foreach (sort keys %$hash) { print "$hash->{$_} "; } print "\n"; }` [download]	[reply] [d/l] [select]
Re: Entering the land of Perl by Discipulus (Canon) on Apr 05, 2013 at 07:42 UTC
Welcome to Perl! this is a wonderful land.. TIMTOWTDT (i'm not a master, take with doubt my code..) `perl -e ' print scalar split (//,$ARGV[0]),"\t", (sort split (//,$ +ARGV[0])),"\n"' TGAC` [download] L* there are no rules, there are no thumbs..	[reply] [d/l]
Re: Entering the land of Perl by hdb (Monsignor) on Apr 05, 2013 at 10:18 UTC
I cannot resist to provide my take on it as well... `use strict; use warnings; my $_ = "AAAGCCCCTTTAAACCCCxxxxxx"; my %h; $h{$_}++ for /./g; print "ACGT only: ", join " ", @h{qw(A C G T)}, "\n"; print "All chars: ", join " ", @h{sort keys%h}, "\n";` [download]	[reply] [d/l]
Re: Entering the land of Perl by Cristoforo (Curate) on Apr 24, 2013 at 22:18 UTC
Or, using the Bio::SeqIO, Bio::Tools::SeqStats modules from the Bio::Seq distribution, you can come up with this, (though more useful for less trivial tasks as the one here). #!/usr/bin/perl use strict; use warnings; use 5.014; use Bio::SeqIO; use Bio::Tools::SeqStats; my $in = Bio::SeqIO->new (-fh => \*DATA, -format=>'fasta'); while(my $seq = $in->next_seq() ) { my $seq_stats = Bio::Tools::SeqStats->new(-seq => $seq); my $count = $seq_stats->count_monomers(); print "Count: A $count->{A} T $count->{T} G $count->{G} C $count-> +{C}\n"; } __DATA__ >NR_037701 1 aggagctatgaatattaatgaaagtggtcctgatgcatgcatattaaaca tgcatcttacatatgacacatgttcaccttggggtggagacttaatattt aaatattgcaatcaggccctatacatcaaaaggtctattcaggacatgaa ggcactcaagtatgcaatctctgtaaacccgctagaaccagtcatggtcg gtgggctccttaccaggagaaaattaccgaaatcactcttgtccaatcaa agctgtagttatggctggtggagttcagttagtcagcatctggtggagct gcaagtgttttagtattgtttatttagaggccagtgcttatttagctgct agagaaaaggaaaacttgtggcagttagaacatagtttattcttttaagt gtagggctgcatgacttaacccttgtttggcatggccttaggtcctgttt gtaatttggtatcttgttgccacaaagagtgtgtttggtcagtcttatga cctctattttgacattaatgctggttggttgtgtctaaaccataaaaggg aggggagtataatgaggtgtgtctgacctcttgtcctgtcatggctggga actcagtttctaaggtttttctggggtcctctttgccaagagcgtttcta ttcagttggtggaggggacttaggattttatttttagtttgcagccaggg tcagtacatttcagtcacccccgcccagccctcctgatcctcctgtcatt cctcacatcctgtcattgtcagagattttacagatatagagctgaatcat ttcctgccatctcttttaacacacaggcctcccagatctttctaacccag gacctacttggaaaggcatgctgggtctcttccacagactttaagctctc cctacaccagaatttaggtgagtgctttgaggacatgaagctattcctcc caccaccagtagccttgggctggcccacgccaactgtggagctggagcgg [download] Output: `C:\Old_Data\perlp>perl t7.pl Count: A 244 T 311 G 232 C 213 C:\Old_Data\perlp>` [download]	[reply] [d/l] [select]