In terms of transforming one file to a series of files, your code might look something like:

my $fh;
my $i = 0;
while (my $line = <$in>) {
    if (new_sequence_test($line)) {
        $i++;
        open $fh, '>', "seq_$i" or die "Open fail seq_$i: $!\n"; 
    }
    print $fh $line;
}
[download]

Update: Now that you've added input and code, I can say a little more. First, while not strictly necessary, strict will help you catch a lot of potential issues and will make variable scoping intent more obvious. See Use strict warnings and diagnostics or die.

When you say while($seq=<IN>), you read in one line of your file. Your split assumes you are slurping your whole file. And especially if file is 'huge', you probably don't want to store it all in memory. Assuming your sequences are split by empty lines, you could modify my already posted code to accomplish your task.

my $fh;
my $i = 0;
while (my $line = <$in>) {
    if (!$fh or $line !~ /\S/) {
        $i++;
        open $fh, '>', "seq_$i" or die "Open fail seq_$i: $!\n"; 
    }
    print $fh $line;
}
[download]

You could also do this very simply by modifying $/, but I suspect that solution would be unclear to you.

Thank you, Ill try your code. Mine didnt work, it put every line of the sequence into a new file, I guess i went wrong at the split.Can you tell me what should I have done instead-just so that I know what I did wrong

There's no generalized tool for separating a huge file with many sequences into different files. ...well, actually there is; it's Perl. But you have to think through your problem and use programming to craft a solution.

So let's get into specifics; if you were to do this with pencil and paper, how would you identify where one sequence ends and another begins? Have you started a solution yet? What can you show us?

Hi bingalee,
I strongly guess you want to save each of the "sequence" starting from XLOC_.. till the space line.
If so,
the following can give you a head up: It saves each "sequence", into a different named file. (am using only the OP data here .... Please)

use warnings;
use strict;

my $fh;

while (<DATA>) {
    chomp;
    if (/(XLOC_\d+$)/) {
        open $fh, '>', "$1.txt" or die $!;
        print $fh $_, $/;
    }
    else {
        print $fh $_, $/;
    }
}

__DATA__
XLOC_000039
>chr1:983051-985037
CATGACTTTGTCGGAATTATGTTACTGCTCATTATCAATTCCACCATTAGCTTCATAGAG
GAAAACAATGCCGGGAATGCTGCTGCTGCGCTTATGGCCCGCCTCGCACCAAAATCCAAG
GTAAGCCCCACACCCTACTTACCACTCCTTTTTCTTCTCAATACTGCTTTTCATCATGTT
ACACTCATTTTCTAGGTTTTACGTGATGGAACCTGGAGTGAAATGGACGCATCTTTGTTG
GTGCCCGGTGACATAATCAGCATTAAACTTGGAGACATCATTCCGGCAGATGCGCGTCTT
CTCGAGGGAGATCCGCTGAAAATTGACCAGGTCTTTCTTGTGTCTCAATCATAGTGTTCT
TGGTAGAGCGGAAAAAAAAATATTCTGATATGAAAATTACATGAGACACTAAAACACATA

XLOC_000456
>chr1:12600284-12601781
CAACAATCTCTGATGATGCGGCAGGGCCTTGCTCGCGGGGCGTGGTGCTACCTCGAGGAT
GAGTTCCTTGGCCAAAGGGAATCCCGGGCGCTTCTACTTGAGACAAAATTCCGCAACTTC
CGCCAAGAGTCCTTGAGCATCACTGACTACTGCCGCCAGCTTGAGTCAATGGCGGCATCC
CTTGCCGGTTTCGGCGATCCCATCGGCGATAGGCAGATGGTGCTCACGCTCCTTCGTGGC
CTCGGCGGCAAGTTCCGTCACATGGTGTCCATCCTCAAGATGCACCAGCCGTTCCCCACG
TTCGCAGAGGCTCGTGCGCACCTGCTGTTGGAGGAGCTGGAAATCGACGCACGACCTCCA
TCACCGCCATCGGCACTTGTTGCTGCAGCGCCGCGGCATGCGACTCCGGGGGCCCCAGTA
[download]