in reply to Simple regex question. Grouping with a negative lookahead assertion.

Like this? 

[0] Perl> $dna = 'atctcggataatgggataaaaatataggctataaatggcgccccggctaatt
+ttt';;
[0] Perl> print $1 while $dna =~ m[atg(.+?)(?=taa|tag|tga)]g;;
gga
gcgccccggc

[download]

If so, the difference is the use of the non-greedy match quantifier +?

With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.

Replies are listed 'Best First'.
Re^2: Simple regex question. Grouping with a negative lookahead assertion.
by Anonymous Monk on Jul 14, 2013 at 01:50 UTC
    That's very close. I was also trying to prevent any characters that were not in the following character class, [acgt], from being included in the match.

    Thanks for the quick response.
[reply]
[d/l]
      I was also trying to prevent any characters that were not in the following character class, [acgt], from being included in the match.

      Is that a possibility? If so, then substitute that for . in my regex. (S'not rocket science.)

      But, if it is a possibility, then you could (should) have included a non-acgt character in your example.

      And if the example you provided is realistic, then using [acgt] is redundant, because your example consists entirely of those characters.

      With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
      Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
      "Science is about questioning the status quo. Questioning authority".
      In the absence of evidence, opinion is indistinguishable from prejudice.
[reply]
[d/l]
[select]
      I just modified and tested the code.

      The minor modification will work. I should have seen the necessary addition of the non-greedy mode quantifier.

      Thanks again.
[reply]

In Section Seekers of Perl Wisdom