in reply to Re^9: Comparing 2 different-sized strings
in thread Comparing 2 different-sized strings

Hi, I hope you are doing well. Thank you for your help. I had another question. If I am searching for 2 sequences within the same haystack, and what separates the 2 sequences is always a "T" followed by one other nucleotide (either A,G,C,or T), how can I do that using the substr? I know how to do this with regular expressions easily, but here it seems I cannot incorporate: 
 substr( $hay, $_, length( $nee )) for fuzzyMatch( \$hay,
+ \$nee, 3 )

[download]
into a regular expression.

Replies are listed 'Best First'.
Re^11: Comparing 2 different-sized strings
by BrowserUk (Patriarch) on Aug 18, 2013 at 13:41 UTC
    If I am searching for 2 sequences within the same haystack, and what separates the 2 sequences is always a "T" followed by one other nucleotide (either A,G,C,or T),

    Could you explain that a bit more?

    I get that you are looking for ???...????T[acgt]???..???; but that criteria will match everywhere a T occurs in a sequence, other than if it is the first, or second or third last, characters in the sequence. And without some constraints on the lengths of the pre & post T sequence length, there would be multiple (100s or 1000s or millions) possible matches at every T position.

    With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
    Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
    "Science is about questioning the status quo. Questioning authority".
    In the absence of evidence, opinion is indistinguishable from prejudice.
[reply]
[d/l]
      Hi, I'm not just looking for the T. For example, if I have the following sequence: 
      $hay = AACCCAGGATGCGCCATGCAGGACACAGGACGCCACGGAA
$nee1 = AGGA
$nee2 = CGCCAC

      [download]
      What I want is the following in regular expression: 
      $hay =~ /($nee1)T[ATGC]($nee2)/

      [download]
      So I only want $nee1 when it is directly followed by a T, some other nucleotide and $nee2. I don't want $nee1 and $nee2 anywhere else.
[reply]
[d/l]
[select]
        What I want is the following in regular expression: $hay =~ /($nee1)T[ATGC]($nee2)/

        Then use the regular expression. It is perfect for that usage.

        fuzzyMatch() is not designed for that type of matching.

        With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
        Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
        "Science is about questioning the status quo. Questioning authority".
        In the absence of evidence, opinion is indistinguishable from prejudice.
[reply]
[d/l]
Re^11: Comparing 2 different-sized strings
by AdrianJ217 (Novice) on Aug 18, 2013 at 13:26 UTC
    Hi, the last post was from me, Adrian. I'm sorry I forgot to log in.
[reply]

In Section Seekers of Perl Wisdom