Re: merge sequences with new sequence insertion

Hi,
You can read one line at a time (for I don't know how large the OP file is), chomp the line, then check if the lines meet your condition using a simply regex, and print it out with the string to insert at the end like so:

 
use warnings;
use strict;

  my $str = 'nnnnncattccattcattaattaattaatgaatgaatgnnnnn';
  while(<DATA>){
   chomp;   
     print $_,$str if !/^>|^$/;
 }

__DATA__
>contig number 11

tttgctcggaggggatc
>contig number 23

gaaaacacttccttattatacaggtaaaccgtatttggat
>contig number 3

aaagctcggaggggatcccct
[download]

This works for me.

If you tell me, I'll forget.
If you show me, I'll remember.
if you involve me, I'll understand.
--- Author unknown to me

Comment on Re: merge sequences with new sequence insertion Download Code

Replies are listed 'Best First'.
Re^2: merge sequences with new sequence insertion by AnomalousMonk (Archbishop) on Nov 26, 2013 at 23:12 UTC
... print it out with the string to insert at the end ... Doesn't that leave you with a `'nnnnnwhatevernnnnn'` "joiner" sequence pasted at the end of the last line of the file? My interpretation of the OP was that joiners should be pasted only between the "contig" sequences. (But I have done no testing of your code.)	[reply] [d/l]
Re^3: merge sequences with new sequence insertion by 2teez (Vicar) on Nov 27, 2013 at 04:59 UTC
Hi AnomalousMonk, Awoshhh!!. My bad! You are right. I think I read wrong, the OP requirement. I think, rnaeye has a better implementation of that. If you tell me, I'll forget. If you show me, I'll remember. if you involve me, I'll understand. --- Author unknown to me	[reply]