Re: Create the reverse complement DNA sequence without pattern matching and reverse built-in function?

Not recommended for production:

use strict;
use warnings;

my $seq='ACGGGAGGACGGGAAAATTACTACGGCATTAGC';
my $rev='';
my $n = length $seq; while( $n-- ){ $rev .= $_ for map chr($_&2?$_^4:$
+_^21), ord substr $seq, $n, 1 }
print "$seq\n$rev\n";
[download]

Something reminds me of Black Jack...

Update: ...or:

use strict;
use warnings;

my $seq='ACGGGAGGACGGGAAAATTACTACGGCATTAGC';
my $rev='';
$rev = "$_$rev" for map chr($_&2?$_^4:$_^21), map ord, split//,$seq;
print "$seq\n$rev\n";
[download]

Comment on Re: Create the reverse complement DNA sequence without pattern matching and reverse built-in function? Select or Download Code