in reply to Re^7: how to access elements in perl
in thread how to access elements in perl

I am using this code given below which you send me. I want to add some more things so that i can count GC% in 0-200, 1-201, 2-202.... upto 1000 or more and if GC% in any region is more than 50% then to take output as: "GC% in more than 50% in this ... region". How can i do this. 
#! perl -slw use strict; my $dna = do{ local $/; <DATA> }; $dna =~ tr[
+\n][]d; my %counts; ++$counts{ substr $dna, $_, 1 } for 0 .. 199; for
+ my $offset ( 0 .. length( $dna )-200 ) { printf "range: %d .. %d A:%
+d C:%d G:%d T:%d\n", $offset, $offset+1 +99, @counts{ qw[ A C G T ] }
+; --$counts{ substr $dna, $offset, 1 }; ++$counts{ substr $dna, $offs
+et+200, 1 }; } __DATA__ TGCCATCGCGCCAGGAGGGAAGACCAGTTGCTCTGGGTAAATCAG
+CCGTGAGCGTATCTGTCCCTCTTAT +AATTAGGAGTTTAAACTCTACGATGTTACC ATCCTTGAATC
+AGGTATATACCGCACTGAAACATCGTCGGCTTTGGGCTCATTCGCTACCCTGTCGCTGA +TATGCGAT
+CTATTCTACATATGCGGGGCCA CCCAATGTCGATTGTCATGAGGAGGGGGTCATAACGACTCACTATA
+GGACCAGCACGTCCGGTTGCGCTG +AGTAAAATAGAGCTACAAAAGACACAGTAC TCCAAGATGTAA
+AGGGGAAGACGGGACCTGGGTCGGGGGCGCAACTTCACTGAGCTTTTAACCTTGCGCG +CATGCGAGA
+GCCTTTCCGCTTAGGAAATGC TGTAAGATCAAGTGGTAGGACTATTGAGAGGTCTTACCTTGCCGCAG
+CAACGTGGACGGCGACCGGATAA +TTTAAGGCCGACATTCAATATAGAATGTCA GGGAGCAGAACTG
+TATCCCAAATGCTAGTTGTAGGTGTACGAGCGCACCTGGGGACCTATCGCTCCGACG +GGGTCTGCGT
+AGCCCATACATCCTGCCAGC ACTGGGGCTATTGAACGGTCAATCCGTAATGTACTCGCTGAATGCTCA
+GGGATTCCTTAATCTTTGAGCA +CGCGGCTTCTCTCACTTTTCTCACGTCAAC CCTGACTCATAACG
+GAGTTCGGCAGTCCCGGAACGGCTTATAGAAGCAATGCCTGAGTAGATAGCGTCAG +GGATCGGCCCT
+ACGTCGAGTCCAGTACGCC ATTGGATGGAGGTCTCAGCCGTCGGTGGAGTGCGGCTCCACCCCCACAT
+GAACGAGGTTGTTCCTGACCA +CCCCTGAAACTGTGAGAACCATTGTGTCGA AACCAAGAGGCTTGC
+GTCGCGCTATAGGTCGATTGCCCCCTAGTTTCCCTATATTGAACGTGTTTCCATT +AAAGACTCTCGG
+TAAATCTCACGTATTGCA

[download]
Produces: 
C:\test>junk77 range: 0 .. 199 A:46 C:51 G:47 T:56 range: 1 .. 200 A:4
+6 C:52 G:47 T:55 range: 2 .. 201 A:46 C:53 G:46 T:55 range: 3 .. 202 
+A:46 C:53 G:46 T:55 range: 4 .. 203 A:47 C:52 G:46 T:55 range: 5 .. 2
+04 A:47 C:52 G:46 T:55 range: 6 .. 205 A:47 C:52 G:46 T:55 range: 7 .
+. 206 A:47 C:51 G:47 T:55 range: 8 .. 207 A:47 C:51 G:46 T:56 range: 
+9 .. 208 A:47 C:51 G:46 T:56 range: 10 .. 209 A:47 C:51 G:46 T:56 ran
+ge: 11 .. 210 A:48 C:50 G:46 T:56 range: 12 .. 211 A:48 C:49 G:46 T:5
+7 range: 13 .. 212 A:47 C:49 G:46 T:58 range: 14 .. 213 A:47 C:49 G:4
+6 T:58 range: 15 .. 214 A:47 C:49 G:45 T:59 range: 16 .. 215 A:46 C:5
+0 G:45 T:59 range: 17 .. 216 A:47 C:50 G:44 T:59 ...

[download]

Replies are listed 'Best First'.
Re^9: how to access elements in perl
by BrowserUk (Patriarch) on May 08, 2014 at 10:43 UTC
    How can i do this.

    Change something; run the code, see how the output changes. Repeat.

    You say you are learning Perl. You won't learn anything until you start trying things for yourself.

    I gave you code to get you started, because that's the hardest part. Now you need to start trying things for yourself.

    When you have a specific problem you cannot solve, I'll help you. But I won't do it for you.

    With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
    Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
    "Science is about questioning the status quo. Questioning authority".
    In the absence of evidence, opinion is indistinguishable from prejudice.
[reply]
      Ok i will try. Thanks.
[reply]
      There is also one another problem, when i execute the above code it gives output starting from 289 - 489.. but not from 0 - 199.
[reply]
        it gives output starting from 289 - 489.. but not from 0 - 199.

        Hm. If you look at the output I posted above, my code outputs the counts for 0 - 199, 1 - 200, 2 - 201, ...

        So what did you change? (Post your current version of the code and don't forget the <code></code> tags.)

        With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
        Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
        "Science is about questioning the status quo. Questioning authority".
        In the absence of evidence, opinion is indistinguishable from prejudice.
[reply]
[d/l]

In Section Seekers of Perl Wisdom