Re^5: substrings that consist of repeating characters

I tried turning

use re 'debug';
[download]

on and comparing the output with

/((.)(?:\2(*SKIP)){$len,})/g
[download]

which seems to work, but I don't understand the output enough to be able to explain why the behaviour is different.

map{substr$_->[0],$_->[1]||0,1}[\*||{},3],[[]],[ref qr-1,-,-1],[{}],[sub{}^*ARGV,3]

Comment on Re^5: substrings that consist of repeating characters Select or Download Code

Replies are listed 'Best First'.
Re^6: substrings that consist of repeating characters by salva (Canon) on Sep 30, 2020 at 07:32 UTC
Aja, that has allowed me to see the problem! The `(SKIP)` inside the repetition always matches, but once the end of the same-char sequence is reached the `\2` fails, so it causes the repetition to backtrack, but it can't because of the `(SKIP)`, so all the repetition fails! Moving the `(SKIP)` after the `\2` fixes the issue: `my $string = "ATTTAGTTCTTAAGGCTGACATCGGTTTACGTCAGCGTTACCCCCCAAGTTTTTTT +TTTTTTTTTTTATTGGGGACTTT"; my $len = 0; my $best = ""; while ($string =~ /((.)(\2(SKIP)){$len,})/g) { $len = length $1; $best = $1 } print "best: $best\n"` [download]	[reply] [d/l] [select]

Replies are listed 'Best First'.

Re^6: substrings that consist of repeating characters
by salva (Canon) on Sep 30, 2020 at 07:32 UTC

The (*SKIP) inside the repetition always matches, but once the end of the same-char sequence is reached the \2 fails, so it causes the repetition to backtrack, but it can't because of the (*SKIP), so all the repetition fails!

Moving the (*SKIP) after the \2 fixes the issue:

my $string = "ATTTAGTTCTTAAGGCTGACATCGGTTTACGTCAGCGTTACCCCCCAAGTTTTTTT
+TTTTTTTTTTTATTGGGGACTTT";

my $len = 0;
my $best = "";
while ($string =~ /((.)(\2(*SKIP)){$len,})/g) {
    $len = length $1;
    $best = $1
}

print "best: $best\n"
[download]

[reply]
[d/l]
[select]