in reply to Not sure how it's working?
the Perl code you've shown splits it into two lines?>hsa-let-7a-5pTGAGGTAGTAGGTTGTATAGTT
Well you "can't get your head around how it's actually doing it" because it doesn't. But shouldn't fasta files have headers on separate lines? That is, aren't header and body different lines to begin with?hsa-let-7a-5p TGAGGTAGTAGGTTGTATAGTT
>hsa-let-7a-5p TGAGGTAGTAGGTTGTATAGTT
|
|---|