Generating mulitple random strings of a set length

Kajed has asked for the wisdom of the Perl Monks concerning the following question:

I am trying to generate random strings from a set string with all of them being the same length and can be found already present inside the known string.

 my $DNA = "AACCGTTAATGGGCATCGATGCTATGCGAGCT";

     $DNA_length = length($DNA);

     my $random_sequence = &random_sequence($DNA);
     my $random_position = &random_position($DNA_length);
     my $random_base = &mutate();

     $DNA[$random_sequence] = $DNA;
     my @DNA_array = split("", $DNA);
     print "$random_position\t$random_base\n";
     $DNA_array[$random_position] = $random_base;
     print join("", @DNA_array), "\n";

     sub random_sequence {
         my $sequence = m/\w*[ACTG]{5}*/;
         my $new_sequence = int(rand(scalar $sequence)
         return $sequence[$new_sequence];

     sub random_position {
         my ($seed) = @_;
         return int(rand($seed));
     }
     sub mutate {
         my @base_array = ('A','C','G','T');
         my $random_base = int(rand(scalar @base_array));
         return $base_array[$random_base];
     }
[download]

I can get the random replacement but i cannot get the random sequence that the replacement is supposed to occur in. I have searched for a similar problem but none that I found helped solve the problem.

Comment on Generating mulitple random strings of a set length Download Code

Replies are listed 'Best First'.
Re: Generating mulitple random strings of a set length by thomas895 (Deacon) on May 08, 2015 at 05:23 UTC
Have you even tried running your own code? How about `use strict`? Or `use diagnostics`? To be specific, look at lines 3, 6, 9, and 16 of your sample. -Thomas "Excuse me for butting in, but I'm interrupt-driven..."	[reply]
Re: Generating mulitple random strings of a set length by aaron_baugher (Curate) on May 08, 2015 at 10:01 UTC
I don't understand what your code is trying to do or why you talk about "replacements," but if you want to get a random substring from a longer string, why not just pick a random offset between 0 and the difference between the full string's length and the substring's length? Here's an iterator which does that: `#!/usr/bin/env perl use 5.010; use warnings; use strict; my $DNA = "AACCGTTAATGGGCATCGATGCTATGCGAGCT"; sub make_rand_getter { my $s = shift; my $sl = length $s; return sub { return substr $s, int rand($sl - $_[0]), $_[0]; } } my $rstring = make_rand_getter($DNA); say "3-letter string: " . $rstring ->(3); say "7-letter string: " . $rstring ->(7);` [download] Aaron B. Available for small or large Perl jobs and *nix system administration; see my home node.	[reply] [d/l]
Re: Generating mulitple random strings of a set length by vinoth.ree (Monsignor) on May 08, 2015 at 10:45 UTC
1.where is your random_sequence function ending curly braces ? 2.what you are trying to do in this line `my $sequence = m/\w[ACTG]{5}/;` 3.`$DNA` argument passed to the random_sequence function but not used in function. 4.`$DNA` get assigned scalar value and later accessing as array in this line `$DNA[$random_sequence] = $DNA;` *All is well. I learn by answering your questions...*	[reply] [d/l] [select]
Re: Generating mulitple random strings of a set length by edimusrex (Monk) on May 08, 2015 at 14:36 UTC
This could be one way to do it with less code. `#!/usr/bin/perl use warnings; use strict; my $DNA = "AACCGTTAATGGGCATCGATGCTATGCGAGCT"; my @rand = split("", $DNA); my $num = @rand; my $max = 5; my @word; for (my $i=0; $i<$max; $i++) { my $x = int(rand($num))-1; push @word, $rand[$x]; } print @word;` [download] By setting the variable $max to the desired length of the out put string.<br/ Of course if you wanted to use the random word as a variable substitute the "print @word" with `my $ranWord = join("",@word); print $ranWord;` [download] or something along those lines to create a variable from the array contents	[reply] [d/l] [select]