in reply to Re: Regular expressions
in thread Regular expressions

Also, I note a reference to codons, which implies that your tests should be considering a stride of 3 rather than an arbitrary position.

This is an excellent point. For the benefit of the OP, here is one way to ensure that only codon-sequences are captured:

#! perl
use strict;
use warnings;

my $seq = 'AATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAACGAA';

# Adapted from the regex by stevieb
my $re =
qr{
    (                           # capture each sequence:
        ATG                     # - which begins with the codon ATG
        (?: [ACGT]{3} )*?       # - followed by the smallest number of
+ codons
        (?: TAG | TAA | TGA )   # - and ending with the codon TAG, TAA
+, or TGA
    )
}x;

print "$1\n" while $seq =~ /$re/g;

[download]

(This assumes that only minimal sequences are wanted — an assumption which should be clarified, as Laurent_R has pointed out, above.)

Hope that helps,

Athanasius <°(((>< contra mundum Iustus alius egestas vitae, eros Piratica,

Replies are listed 'Best First'.
Re^3: Regular expressions
by AnomalousMonk (Archbishop) on Oct 27, 2015 at 07:27 UTC

    I would have organized the code slightly differently, factoring each of the pattern elements into a separate  qr// regex object and combining them together (inside a capture group) in the final  m// match: 

    c:\@Work\Perl\monks>perl -wMstrict -le
"my $codon = qr{ [ACGT]{3}       }xms;
 my $start = qr{ ATG             }xms;
 my $end   = qr{ TAG | TAA | TGA }xms;
 ;;
 my $seq = 'AATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAACGAA';
 ;;
 print qq{'$1'} while $seq =~ m{ ($start $codon*? $end) }xmsg;
"
'ATGGTTTCTCCCATCTCTCCATCGGCATAA'
'ATGATCTAA'

    [download]
    Separate  qr// definitions ease maintenance and, if variable names be wisely chosen, are self-commenting. If possible, I only use capture groups in the final  m// match due to the confusion that trying to count nested capture groups can produce.

    Give a man a fish:  <%-{-{-{-<

[reply]
[d/l]
[select]

In Section Seekers of Perl Wisdom