in reply to Print A Sequence with Start codon and different Stop Codon
#!/usr/bin/perl # http://perlmonks.org/?node_id=1146191 use strict; use warnings; my $sequence = 'AATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAACGAA' +; $sequence =~ /(ATG.*?(?:TAG|TAA|TGA))(??{print "$1\n"})/;
which prints:
ATGGTTTCTCCCATCTCTCCATCGGCATAA ATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGA ATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAA ATGATCTAA
|
|---|
| Replies are listed 'Best First'. | |
|---|---|
|
Re^2: Print A Sequence with Start codon and different Stop Codon
by PerlKc (Novice) on Oct 28, 2015 at 01:44 UTC | |
|
Re^2: Print A Sequence with Start codon and different Stop Codon
by PerlKc (Novice) on Oct 28, 2015 at 01:50 UTC | |
by Anonymous Monk on Oct 28, 2015 at 01:56 UTC | |
by Anonymous Monk on Oct 28, 2015 at 12:08 UTC | |
by Anonymous Monk on Oct 28, 2015 at 13:42 UTC | |
by Anonymous Monk on Oct 28, 2015 at 13:52 UTC | |
|