in reply to Understanding a portion on the Perlretut
I think the documentation is a little misleading here. At least, it gives me the impression that the first match (if any) is somehow guaranteed to be valid (because codon-aligned). But that’s true only if, as in the example given, the $dna string happens to contain a valid match somewhere — in which case, it will be found first. But if it doesn’t, the first match is an invalid one:
#! perl use strict; use warnings; while (my $dna = <DATA>) { chomp $dna; print "\n\$dna = '$dna'\n"; while ($dna =~ /(\w\w\w)*?TGA/g) { print 'Got a TGA stop codon at position ', pos $dna, ', immediately following [', $1, "]\n"; } } __DATA__ ATCGTTGAA ATCGTTGAATGCAAATGACATGAC
Output:
0:10 >perl 1476_SoPW.pl $dna = 'ATCGTTGAA' Got a TGA stop codon at position 8, immediately following [CGT] $dna = 'ATCGTTGAATGCAAATGACATGAC' Got a TGA stop codon at position 18, immediately following [AAA] Use of uninitialized value $1 in print at 1476_SoPW.pl line 43, <DATA> + line 2. Got a TGA stop codon at position 23, immediately following [] 0:10 >
Adding a \G anchor to the regex:
while ($dna =~ /\G(\w\w\w)*?TGA/g)
fixes the results for both dna strings, because \G means Match only at pos() (e.g. at the end-of-match position of prior m//g) (see “Assertions” in perlre), and initially pos() is set at zero.
<Begin update> choroba is of course correct, anchoring to the start of the string finds only the first match.
But that means that the regex could also be fixed without recourse to \G, by simply anchoring it to the start of the string:
while ($dna =~ /^(\w\w\w)*?TGA/g)
<End update>
Perhaps not Perl documentation’s finest hour. :-)
Hope that helps,
| Athanasius <°(((>< contra mundum | Iustus alius egestas vitae, eros Piratica, |
|
|---|
| Replies are listed 'Best First'. | |
|---|---|
|
Re^2: Understanding a portion of perlretut
by choroba (Cardinal) on Dec 09, 2015 at 16:57 UTC | |
|
Re^2: Understanding a portion of perlretut
by Corion (Patriarch) on Dec 09, 2015 at 15:19 UTC | |
by BlueStarry (Novice) on Dec 09, 2015 at 15:52 UTC | |
by Corion (Patriarch) on Dec 09, 2015 at 15:55 UTC | |
by BlueStarry (Novice) on Dec 09, 2015 at 16:15 UTC | |
by AnomalousMonk (Archbishop) on Dec 09, 2015 at 22:04 UTC | |
| |
|
Re^2: Understanding a portion of perlretut
by BlueStarry (Novice) on Dec 09, 2015 at 15:16 UTC |