The following is a parallel demonstration for the fasta benchmark on the web. It runs nearly 3x faster versus the original code.

Although nothing is relayed between workers, the relay capabilities in MCE is helpful for running a section of code orderly. A shared-scalar variable is used for retaining the $LAST value between chunks and subsequent runs.

# perl fasta.pl 25000000 # The Computer Language Benchmarks game # http://benchmarksgame.alioth.debian.org/ # # contributed by Barry Walsh # port of fasta.rb #6 # # MCE version by Mario Roy use strict; use warnings; use feature 'say'; use MCE; use MCE::Candy; use MCE::Shared; use constant IM => 139968; use constant IA => 3877; use constant IC => 29573; my $LAST = MCE::Shared->scalar(42); my $alu = 'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' . 'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' . 'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' . 'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' . 'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' . 'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' . 'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA'; my $iub = [ [ 'a', 0.27 ], [ 'c', 0.12 ], [ 'g', 0.12 ], [ 't', 0.27 ], [ 'B', 0.02 ], [ 'D', 0.02 ], [ 'H', 0.02 ], [ 'K', 0.02 ], [ 'M', 0.02 ], [ 'N', 0.02 ], [ 'R', 0.02 ], [ 'S', 0.02 ], [ 'V', 0.02 ], [ 'W', 0.02 ], [ 'Y', 0.02 ] ]; my $homosapiens = [ [ 'a', 0.3029549426680 ], [ 'c', 0.1979883004921 ], [ 'g', 0.1975473066391 ], [ 't', 0.3015094502008 ] ]; sub make_repeat_fasta { my ($src, $n) = @_; my $width = qr/(.{1,60})/; my $l = length $src; my $s = $src x (($n / $l) + 1); substr($s, $n, $l) = ''; while ($s =~ m/$width/g) { say $1 } } sub make_random_fasta { my ($table, $n) = @_; my $rand = undef; my $width = 60; my $prob = 0.0; my $output = ''; my ($c1, $c2, $last); $_->[1] = ($prob += $_->[1]) for @$table; $c1 = '$rand = ($last = ($last * IA + IC) % IM) / IM;'; $c1 .= "\$output .= '$_->[0]', next if $_->[1] > \$rand;\n" for @$ +table; my $code1 = q{ my ($mce, $seq, $chunk_id) = @_; # process code-snippet orderly between workers MCE->relay_recv; my $last = $LAST->get; my $temp = $last; # pre-compute $LAST for the next worker for (1 .. ($seq->[1] - $seq->[0] + 1) * $width) { $temp = ($temp * IA + IC) % IM; } $LAST->set($temp); MCE->relay; # process code-snippet in parallel for ($seq->[0] .. $seq->[1]) { for (1..$width) { !C! } $output .= "\n"; } # gather output orderly MCE->gather($chunk_id, $output); $output = ''; }; $code1 =~ s/!C!/$c1/g; MCE->new( bounds_only => 1, chunk_size => 2000, init_relay => 0, max_workers => 4, ## MCE::Util->get_ncpu || 4, sequence => [ 1, ($n / $width) ], gather => MCE::Candy::out_iter_fh(\*STDOUT), user_func => sub { eval $code1; }, use_threads => 0, )->run; $last = $LAST->get; $c2 = '$rand = ($last = ($last * IA + IC) % IM) / IM;'; $c2 .= "print('$_->[0]'), next if $_->[1] > \$rand;\n" for @$table +; my $code2 = q{ if ($n % $width != 0) { for (1 .. $n % $width) { !C! } print "\n"; } }; $code2 =~ s/!C!/$c2/g; eval $code2; $LAST->set($last); } my $n = $ARGV[0] || 27; say ">ONE Homo sapiens alu"; make_repeat_fasta($alu, $n*2); say ">TWO IUB ambiguity codes"; make_random_fasta($iub, $n*3); say ">THREE Homo sapiens frequency"; make_random_fasta($homosapiens, $n*5);

Regards, Mario.