in reply to I'm trying to print the contents of a hash to newly created files

Hi Peter Keystrokes,

Could you please provide a sample of your data from your file? Even just a few lines surrounded by code tags would be useful.

Just another Perl hooker - Working on the corner... corner conditions that is.
  • Comment on Re: I'm trying to print the contents of a hash to newly created files

Replies are listed 'Best First'.
Re^2: I'm trying to print the contents of a hash to newly created files
by Peter Keystrokes (Beadle) on May 08, 2017 at 17:42 UTC
    Typical fasta file for DNA/RNA sequences:
    >hsa_circ_0000001|chr1:1080738-1080845-|None|None ATGGGGTTGGGTCAGCCGTGCGGTCAGGTCAGGTCGGCCATGAGGTCAGGTGGGGTCGGCCATGAAGGTG +GTGGGGGTCATGAGGTCACAAGGGGGTCGGCCATGTG >hsa_circ_0000002|chr1:1158623-1159348-|NM_016176|SDF4 GGTGGATGTGAACACTGACCGGAAGATCAGTGCCAAGGAGATGCAGCGCTGGATCATGGAGAAGACGGCC +GAGCACTTCCAGGAGGCCATGGAGGAGAGCAAGACACACTTCCGCGCCGTGGACCCTGACGGGGACGGT +CACGTGTCTTGGGACGAGTATAAGGTGAAGTTTTTGGCGAGTAAAGGCCATAGCGAGAAGGAGGTTGCC +GACGCCATCAGGCTCAACGAGGAACTCAAAGTGGATGAGGAAA