sub wrap {
    my ($lines, $pos, $markup) = @_;
    my $idx = int($pos / 50);
    substr $lines->[$idx], $pos % 50, 0, $markup;
}


my %dna;
my $name1 = "name1";
my $name2 = "name2";

$dna{$name1} = "ATATTATCCCCCTATATATGGAGGGAGAGGGGGGGGGGGGGGGGGGGGGGGGGG
+GAGAGAGGAGATTTTTTTTTTTTTTTT";
$dna{$name2} = "ATATATTATATATATTATATTCGCGCGCGCGGCGCGCGCGGCGCGCGCGTTTTT
+TTTTTTTTTAGGAGAGAGAGGGAGGAGGAGAGGGGAGT";

my %class =(AGGAG => 'sd',
            TTTTT => 'terminator');
my $regex = join '|', keys %class;
$regex = qr/((?i:$regex))/;

my %highlight;
for my $name (keys %dna)  {
    while ($dna{$name} =~ /$regex/g) {
        $highlight{$name}{ pos($dna{$name}) - 5 } = $class{$1};
    }
}

for my $key (keys %highlight)  {
    print "<p> <b>$key</b><input type='radio' name='selected_intergeni
+c' value='$dna{$key}'/> </p>";
    my @lines = unpack '(A50)*', $dna{$key};
    for my $pos (sort { $b <=> $a } keys %{ $highlight{$key} }) {
        my $class = $highlight{$key}{$pos};
        wrap(\@lines, $pos + 5, '</span>');
        wrap(\@lines, $pos, "<span class='$class'>");
    }
    print join "<br />", @lines;
}
[download]

($q=q:Sq=~/;[c](.)(.)/;chr(-||-|5+lengthSq)`"S|oS2"`map{chr |+ord
}map{substrSq`S_+|`|}3E|-|`7**2-3:)=~y+S|`+$1,++print+eval$q,q,a,
[download]

Many Thanks this is working and it is exactly what I was trying to do. Many many thanks I have been trying to sort this out for a while now, and I was abou to give up and have a massively wide page. Do you think (be honest) this was a a good question? I could not find a similar question anywhere, and when I have tried asking it on SO, I have been heavily downvoted, criticized and offended. That is why I was also very hesitant into asking here; do not wanna appear as lazy, but I tried all I could think of. I honestly thought this was a decent question for beginners and I tried providing as much material as I could. Thanks again.

I was wondering: I have noticed you use "5" in your solution; what if the patterns are of different length?

You can store the lengths in the %class hash:

my %class =(AGGAG => { name => 'sd' },
            TT    => { name => 'terminator' });  # I shortened the ter
+minator for testing
$class{$_}{length} = length $_ for keys %class;

# ...

        $highlight{$name}{ pos($dna{$name}) - $class{$1}{length} } = $
+class{$1};

# ...

        my $class = $highlight{$key}{$pos};
        wrap(\@lines, $pos + $class->{length}, '</span>');
        wrap(\@lines, $pos, "<span class='$class->{name}'>");
[download]

($q=q:Sq=~/;[c](.)(.)/;chr(-||-|5+lengthSq)`"S|oS2"`map{chr |+ord
}map{substrSq`S_+|`|}3E|-|`7**2-3:)=~y+S|`+$1,++print+eval$q,q,a,
[download]

If I understand you correctly, all you need is something like this:

#!/usr/bin/env perl 
use strict;
use warnings;

my $in = "ATATATTATATATATTATATTCGCGCGCGCGGCGCGCGCGGCGCGCGCGTTTTTTTTTTT
+TTTAGGAGAGAGAGGGAGGAGGAGAGGGGAGT";
my $out = '<pre>' . join ("\n", $in =~ /[ATCG]{1,50}/g) . "</pre>\n";
print $out;
[download]

Use HTML pre tags for preformatted output.

this does not work; lines end up being of different length and the colours disappear. To simplify my task to the minimum, imagine, still inside a CGI script you have 2 strings:

my $a: "ABCDEFGHI"
my $b: "<b>ABC</b>DEFGHI"
[download]

I want to print this 2 strings with 4 characters per line and in the second string ABC has to be in bold; If I use my method, or your method, this is what I get:

$a:
ABCD
EFGH
I
$b:
<b>A
BC</
b>DE
FGHI
[download]

I want the bold tags ingored in the characters counts: So:

$a:
ABCD
EFGH
I
$b:
<b>ABC</b>D
EFGH
I
[download]

Also as I said, when I try your code it also does something with the coloured tags I used; Note: in this example I am using bold tag to make it shorter, in my scrip I am using a span class as shown. I hope it is more clear. I do not know in advance where the position it is: i need an universal solution which can print something with the same number of characters per line, basically ignoring the tags in the counts.

I see. If you have tags already in your data and want to skip over them then the best plan is to use a proper HTML parser.

If you cannot (or will not) use a parser then a crude plan B which works for your supplied dataset is:

#!/usr/bin/env perl 
use strict;
use warnings;
use Test::More;

my @set = (
    {
        in => 'ABCDEFGHI',
        want => "ABCD\nEFGH\nI\n"
    },
    {
        in => '<b>ABC</b>DEFGHI',
        want => "<b>ABC</b>D\nEFGH\nI\n"
    },
);
plan tests => scalar @set;
my $len = 4;

for my $x (@set) {
    my $i = 0;
    my $out = '';
    my $intag = 0;
    for my $c (split (//, $x->{in})) {
        $out .= $c;
        $intag++ if $c eq '<';
        $intag-- if $c eq '>';
        next if $intag || $c eq '>';
        $i++;
        $out .= "\n" unless $i % $len;
    }
    $out .= "\n";

    is ($out, $x->{want});
}
[download]

This isn't robust (and is rather C-ish for my taste) but it serves to illustrate this approach in general terms. Have fun with it.

Update: edited source for improved generality.

This counts along the string and inserts line breaks at regular intervals

#!/usr/bin/perl
use strict;
use warnings;
use CGI;

my $WIDTH = 40;

my %hash = (
 'name1' => "ATATTATCCCCCTATATATGGAGGGAGAGGGGGGGGGGGGGGGGGGGGGGGGGGGAG
+AGAGGAGATTTTTTTTTTTTTTTT",
 'name2' => "ATATATTATATATATTATATTCGCGCGCGCGGCGCGCGCGGCGCGCGCGTTTTTTTT
+TTTTTTAGGAGAGAGAGGGAGGAGGAGAGGGGAGT",
);

my @select=();
my %pattern = (
  'AGGAG' => 'sd',
  'TTTTTTT' => 'terminator'
);
my $re = join '|',keys %pattern;

# add markup
foreach my $key (sort keys %hash)  {
  if ($hash{$key} =~ s!($re)!<span class="$pattern{$1}">$1</span>!g){
    push @select,$key;
  }
}

# create table
my $table = q!<table width="100" cellpadding="5" cellspacing="5">
<tr style="font-style:italic">
  <td width="20%">Key</td>
  <td width="5%">&nbsp;</td>
  <td width="75%">Sequence</td>
</tr>!;

# selected keys
foreach my $key (@select)  {
  my $seq = $hash{$key};
  
  # count ACTG character to determine 
  # position to insert line breaks
  my $count = 0; my @br;
  for my $p (0..length($seq)-1){
    ++$count if substr($seq,$p,1) =~ /[ACTG]/;
    if ($count > $WIDTH){
      push @br,$p;
      $count = 1;
    };
  }
  
  # insert line breaks working backwards
  for my $p (reverse @br){
    substr($seq,$p,0,'<br/>');
  }
  
  # create row
  my $radio = qq!<input type="radio" name="selected_intergenic" value=
+"$key"/>!;
  $table .= qq!<tr valign="top">
  <td>$key</td>
  <td>$radio</td>
  <td>$seq</td></tr>!;
}
$table .= q!</table>!;

# html page 
my $q = CGI->new;

my $style = <<EOF;
body {  
  background: lightgrey; color: black; 
  font-family: Courier; margin:20px; }
h1 { color: black; font-family: Verdana; font-size: 150%; }
h2 { color:red; font-family: Courier; }
.sd { color:red; }
.terminator { color: royalblue; }
EOF

my $note = qq!Sequences with <span class="sd"> SD sequence</span>  
or <span class="terminator">terminator structure</span>!;

print $q->header,
$q->start_html(-style=>{'code'=>$style}),
$q->h1( $note ),
$table,
$q->end_html;
[download]