in reply to Re^3: Making use of a hash of an array...
in thread Making use of a hash of an array...
This of course, is a segment of a larger genetic sequence consisting of the nucleotides adenine(A), thymine(T), cytosine(C) and guanine(G).#col_1 col_2 col_3 col_4 col_5 GTCT GC TTCAGTGACTTCGAGGCGCG GC GTCC
Where G binds to C
and A binds to T
It just so happens that in this position there is a potential for the sequence to bind in on itself forming a hairpin this is more popularly referred to as a 'genetic palindrome'.I'll try to explain.
There are 5 columns.
-Columns 2-4 represent the entire hairpin.
-Columns 2 and 4 represent the stem
-Column 3 represents the 'spacer' or 'gap' which forms the loop
-Columns 1 and 5 represent the nucleotide flanking either side of the hairpin.
Now you may notice that in my data some of the rows basically represent the same sequence, except with an extended stem. Such as:______ / \ | | <--- The SPACER \ / \ / C---G <--- The STEM G---C ____/ \_____ <--- The FLANK
Now of the 4 options of a hairpin I want to choose the most extended hairpin which is:12 .. 35 TCT GC TTCAGTGACTTCGAGGCGCG GC AGCT 11 .. 36 GTC TGC TTCAGTGACTTCGAGGCGCG GCA GCTG 10 .. 37 GGT CTGC TTCAGTGACTTCGAGGCGCG GCAG CTGC 9 .. 38 TGG TCTGC TTCAGTGACTTCGAGGCGCG GCAGC TGCT
Because its stem is more robust than the relatively flimsy stem of:9 .. 38 TGG TCTGC TTCAGTGACTTCGAGGCGCG GCAGC TGCT
Which has a measly stem of 2 bases and probably won't maintain the hairpin structure long enough in the busyness of molecular processing to have any real molecular influence in terms of gene regulation or what have you... But then again nature/biology is full of surprises and exceptions as always... :S12 .. 35 TCT GC TTCAGTGACTTCGAGGCGCG GC AGCT
So what I wanted to do is write a script that reads in these start and end values and basically detects the presence of what is essentially one hairpin, by taking the hairpin with the most extended stem. As far as I know, the data will allow for this to be achieved.
I hope this helps.
|
|---|
| Replies are listed 'Best First'. | |
|---|---|
|
Re^5: Making use of a hash of an array...
by haukex (Archbishop) on Jul 23, 2017 at 20:44 UTC |