in reply to Identifying Overlapping Matches in Nucleotide Sequence
"... matching pairs..."
By chance I found this and slightly adopted it:
#!/usr/bin/env perl use strict; use warnings; use Data::Dump; use feature qw(say); my @s = split //, "AAAA"; my @m = map { $s[$_] . ' ' . $s[ $_ + 1 ] } 0 .. $#s - 1; dd \@m; say scalar @m; __END__
I'm still wondering why it works ;-)
Update: Getting the letters:
dd grep { $_ ne "" } split /[^A]/, q(AAGAATGCCAGTTTGTAAGTACTGACTTTGGAAAA);Regards, Karl
«The Crux of the Biscuit is the Apostrophe»
perl -MCrypt::CBC -E 'say Crypt::CBC->new(-key=>'kgb',-cipher=>"Blowfish")->decrypt_hex($ENV{KARL});'Help
|
|---|