in reply to Identifying Overlapping Matches in Nucleotide Sequence

"... matching pairs..."

By chance I found this and slightly adopted it:

#!/usr/bin/env perl use strict; use warnings; use Data::Dump; use feature qw(say); my @s = split //, "AAAA"; my @m = map { $s[$_] . ' ' . $s[ $_ + 1 ] } 0 .. $#s - 1; dd \@m; say scalar @m; __END__

I'm still wondering why it works ;-)

Update: Getting the letters:

dd grep { $_ ne "" } split /[^A]/, q(AAGAATGCCAGTTTGTAAGTACTGACTTTGGAAAA);

Regards, Karl

«The Crux of the Biscuit is the Apostrophe»

perl -MCrypt::CBC -E 'say Crypt::CBC->new(-key=>'kgb',-cipher=>"Blowfish")->decrypt_hex($ENV{KARL});'Help