in reply to Faster and more efficient way to read a file vertically

I put together a benchmark for most of the suggested solutions (or adaptations of them to get consistent results) and ran tests against an inline dataset of 50 lines with Test::More then with a 50,000 line file produced by this one-liner.

perl -E ' my @alpha = ( qw{ A C G T } ) x 5; push @alpha, qw{ . . }; say join q{}, map { $alpha[ rand @alpha ] } 1 .. 50 for 1 .. 50000;' > spw1202693.txt

Here's the script.

use strict; use warnings; use Benchmark qw{ cmpthese }; use Test::More qw{ no_plan }; open my $inFH, q{<}, \ <<__EOD__ or die $!; TATCGC.TGCCC.ATTAAGCCATACTTCAAGGATCCCCCCG.GA.GGGCA GGAGTCGTC.ACACATCTTCACTAC.CATATCTTGCTACGGCCACTGACA CGA.A.CAATTTTCGAATGGAGGGCGAATGCCGTTGTGCGCTGCGTGACG TCT.AGCCT.CGAA.A.GCAGGCGTGGGGCGTACCACGGCTTGGCCTAT. ATGCACTT.AA.CCCTCGTAT.CTCTACTCT.ACAACCTTGGGCAG.T.T TAGGGC.CCGCG.TAAACTGCAGATAGTACTCCAAGAATCGCTCCGACCC .CGTCTAAACAATTAGCGGAGGTCGTC.CTGCAA.CAATGATCTTAACAC AG.AAGAAGT.CAAAGT.GTAGTGGCTGGGTACTTGATCA.TCAATTTCA ACC.TTCCAG.AAATGAGGTCTC.AAAAG.AGTT.CCTG.GGCTGTGTAG ACAT.A.TGTTAACACCACCTATAATAGAAGC.TTATATTCACC.TTAAC GAATTGT.TTCAATGCCACATA.GCTGGGCCAC.GCCTTAGGCTATTT.A AGCTTTACAGATGT.ACCAAA.CCAG.GACTAGATGGGGGGG.ATATGCC AGAAAGCCC.TCCCTGCGAAT.TGGGGGAGTACT.ATAGACTA.GGCCAG .CACTCCGG.CTAACACTACTTCCTGTAACAAA.CTGAAGAGA.CGTTTG CAGTCCTGAGCGTGCTAC..GTTCT.CTGTCG.TTAGATGGGCGC..GTA AGCAAGAAAACACGTACAGAAAAAGCCGACGGC.GGGGTTC.GTCAACC. T.ACTTATCGACATTAGCATCTGG.TGCCGCCTTT.GAACCCATTACTCG TAAACGA.CACCGCTTAGGGCTGACCTCCGAA.TTATCAGAGTACCGGGC ACGGATATCCTA.ATAGA.TACCTATGTAGGAAG.TCGAACTC.TAAACT ACCCCCGTCC.TATCCTC.CGA.ATTGCCCCCGGCCGTACTCCA.AAACC T..TC.AGCCGGG.TTG.TGTGGATCAGAAGTGATTGAGACTGG.GCCTA TCAACCTTGAAGTTGAAACTCCGAGAGT.CGCGGTCAACC.AGCCTGCGC GATCAGTGAGGAGCTGT.C.AAAGC.TC.AG.GCC.G.GA.GTGAGATT. G.C.AGTTTGCCACTT.CATCCAGAGTTCATCCAGCAGG.ATTGAAGTTA GCGCTGCA.CTGT.CATTTTTTATTCCCACCCGGTCTCCCCAACCCCGAT TGTATAGCCAGG.CGGAG.TTTCTT.TAGATCTAGTAAGACATT.CCCGA AC.CCCCT.G.TAGCTAAATCGACGGG..GTCAATATACACGGAT.CTTT AAGC.GGGCTGATGCTTATCTCCTAGCCCGC.CCTCGATGAT.ATTATTG TCACCC.ACCGC..T.CGGAACGAAAACT..AT.CCTATTAGAACATCCT .GCGTGAACC.TG.G.TACACCG.GATGGTCCCGAC.GGCTACCGAT.CA .CGCTGCCCCCATCTCCAGCTATC.AAA.AGGGACGCGATATGCGGAAGC CGTTCAGACAATCCTTTTGGGGTGTAAATGTCTCC.ACCTC.GAGA.CTG AAGACATAGGAG.CCAGAAT.A.CGTCATACAGAGGCACTC.TAT..TCT AGGCCTGCCTACTT.TTGGCTAA.C.AGACTTGG.AAG.ATGTAGAAC.G GTCAACCCGTGCTAACTGGGGTGAGGAATCTTCCGAGCC.TGCTCGTCGC TCG.TGGCAGCTC.AACTGGTGCGCGGCAG.CCTCCTGCCAAGTATTCAG CGGGGGCTAC..GTT.TCATCGAACACGGCACACTAACAAACTCCTGTGT TTCCGGGGTCGACCCTTTGGCCCAAGAGTGA.AGGGCTTCG.ACTGCG.. AA.CGTGCGGGTAGCCTAGACACGTAGC.TTGTGCGC.CG.CGCA.CAAG AT.TATGTCA.ACTTCCGCCGGG.CTTCTGTGTACATT.AA.GAGAATAA CGGCAAGGATTGCTCGACGTAGGAGTCCGTGGAGCTCGTGC.GACC.ACC .GTTAA.CACGCCTTAACTTTTCGGAACAGAGTAAC.AATCCCGG.TA.C CAGGTAATGTGTCACCAGGTTCGGGCCCT.CACCGTCCCAGCTAC.TGTT TAGCCCCTCTTTT.GAT.GGCCC.AGCGACATCAA.TGATC..CTGTAGG CGATCATATTTCATTGTTCCGC.TG.AGCGGT.A.TG.GCAAT.CAGCCG ATCGATGTTCTGATATG..GTGTGAATAC.AGAAACCGGCTTTGTCGGGG CCTTT.AGGAA.AC.TAGGT.TT.CTCAATGAAC.GACATCAAC.T.AGC AAGGAGGTACACAGCGTTCAGCGGATCC.CT.AAGC.TAGCATCTGCTGA GCAGATA.A.TCTGCTTCAACTGTGAAAGGGTTG.CTAATCAG.GCGTAG GGTACGATC.GCAAC.AGTCCACAAGTACACGGTGGAATT.CC..C.TTG __EOD__ my $fileStart = tell $inFH; my $offset = 9; # Column 10 if numbering from 1 my $testOK = q{C.T.AGCTGTTG..GAGACCCAGGCAGTCCCAGTTGCCGATCTTTCAC..}; my %methods = ( rsubstr => sub { # BrowserUk's method seek $inFH, 0, 0; my $buffer; my $rsWanted = \ substr $buffer, $offset, 1; my $retStr; while ( $buffer = <$inFH> ) { $retStr .= ${ $rsWanted }; } return \ $retStr; }, brutish => sub { # Adapted from Anonymonk's brute force method seek $inFH, 0, 0; my $retStr; while ( <$inFH> ) { my @split = split m{}; $retStr .= $split[ $offset ]; } return \ $retStr; }, seek => sub { # Suggested by vr seek $inFH, 0, 0; my $retStr; my $char; my $len = length( <$inFH> ) - 1; seek $inFH, $offset, 0; while ( read $inFH, $char, 1 ) { $retStr .= $char; seek $inFH, $len, 1 } return \ $retStr; }, substr => sub { # Suggested by pryrt and Laurent_R seek $inFH, 0, 0; my $retStr; while ( <$inFH> ) { $retStr .= substr $_, $offset, 1; } return \ $retStr; }, regex => sub { # Another of pryrt's solutions seek $inFH, 0, 0; my $retStr; while ( <$inFH> ) { $retStr .= $1 if m{^.{$offset}(.)}; } return \ $retStr; }, unpack => sub { # Suggested but not implemented by LanX & pryrt seek $inFH, 0, 0; my $retStr; my $fmt = qq{x${offset}a}; while ( <$inFH> ) { $retStr .= unpack $fmt, $_; } return \ $retStr; }, unpackM => sub { # Multi-line unpack suggested by LanX seek $inFH, 0, 0; my $buffer = <$inFH>; my $lineLen = length $buffer; my $nLines = 500; my $chunkSize = $lineLen * $nLines; seek $inFH, 0, 0; my $retStr; my $fmt = qq{(x${offset}ax@{ [ $lineLen - $offset - 1 ] })*}; while ( my $bytesRead = read $inFH, $buffer, $chunkSize ) { $retStr .= join q{}, unpack $fmt, $buffer; } return \ $retStr; }, split => sub { # Simple split from thanos1983 seek $inFH, 0, 0; my $retStr; my $fmt = qq{x${offset}a}; while ( <$inFH> ) { $retStr .= ( split m{} )[ $offset ]; } return \ $retStr; }, pushAoA => sub { # In memory solution from Discipulus seek $inFH, 0, 0; my @aoa; while ( <$inFH> ) { chomp; push @aoa, [ split m{} ]; } my $retStr = join q{}, map { $aoa[ $_ ]->[ $offset ] } 0 .. $#a +oa; return \ $retStr; }, ANDmask => sub { # Multi-line AND mask by johngg seek $inFH, 0, 0; my $buffer = <$inFH>; my $lineLen = length $buffer; my $nLines = 500; my $chunkSize = $lineLen * $nLines; seek $inFH, 0, 0; my $retStr; my $mask = qq{\x00} x ${offset} . qq{\xff} . qq{\x00} x ( $lineLen - $offset - 1 ); $mask x= $nLines; while ( my $bytesRead = read $inFH, $buffer, $chunkSize ) { ( my $anded = $buffer & $mask ) =~ tr{\x00}{}d; $retStr .= $anded; } return \ $retStr; }, ); foreach my $method ( sort keys %methods ) { ok( ${ $methods{ $method }->() } eq $testOK, $method ); } close $inFH or die $!; my $filename = q{spw1202693.txt}; open $inFH, q{<}, $filename or die qq{open: < $filename: $!\n}; cmpthese( -3, { map { my $codeStr = q[sub { my $col = $methods{ ] . $_ . q[ }->(); }]; $_ => eval $codeStr; } keys %methods } ); close $inFH or die qq{close: < $filename: $!\n};

And the results.

ok 1 - ANDmask ok 2 - brutish ok 3 - pushAoA ok 4 - regex ok 5 - rsubstr ok 6 - seek ok 7 - split ok 8 - substr ok 9 - unpack ok 10 - unpackM Rate pushAoA brutish split seek regex unpack substr rsubstr + unpackM ANDmask pushAoA 1.11/s -- -35% -61% -62% -91% -97% -98% -98% + -98% -99% brutish 1.71/s 55% -- -39% -41% -86% -95% -96% -96% + -97% -98% split 2.82/s 155% 65% -- -3% -77% -92% -94% -94% + -95% -97% seek 2.91/s 163% 70% 3% -- -76% -92% -94% -94% + -95% -97% regex 12.3/s 1010% 617% 336% 322% -- -65% -74% -75% + -79% -88% unpack 35.0/s 3060% 1943% 1141% 1102% 185% -- -25% -27% + -40% -67% substr 46.9/s 4137% 2638% 1564% 1512% 282% 34% -- -3% + -20% -55% rsubstr 48.2/s 4254% 2714% 1610% 1556% 292% 38% 3% -- + -18% -54% unpackM 58.7/s 5194% 3321% 1979% 1914% 377% 68% 25% 22% + -- -44% ANDmask 105/s 9407% 6045% 3634% 3517% 757% 201% 124% 118% + 80% -- 1..10

The two substr solutions are neck and neck in the lead, unpack a distant third and everything else well behind. However, I have cocked up benchmarks before so take this with a pinch of salt!

Update: Corrected attribution of the "unpack" method and incorporated the two new methods and benchmark results from this post. Working with multi-line buffers using unpack or a mask to AND with the buffer seems to be the fastest approach.

Cheers,

JohnGG

Replies are listed 'Best First'.
Re^2: Faster and more efficient way to read a file vertically
by vr (Curate) on Nov 05, 2017 at 17:22 UTC

    Interesting. I had similar partial synthetic benchmark yesterday, thought to publish it mainly to advice against my "seek" solution as too slow, then decided not to :), because maybe it's not worth readers' effort.

    Nevertheless, somewhat different results for a 1 million lines file, and fast NVMe SSD storage. Below is the case for returning a hash with chars counts, but it's similar for returning string.

    $ perl vert2.pl ok 1 - same results ok 2 - same results ok 3 - same results (warning: too few iterations for a reliable count) (warning: too few iterations for a reliable count) (warning: too few iterations for a reliable count) (warning: too few iterations for a reliable count) Rate seek buk substr slurp seek 0.920/s -- -61% -84% -88% buk 2.36/s 157% -- -58% -69% substr 5.66/s 515% 140% -- -26% slurp 7.69/s 736% 226% 36% -- 1..3

      The following provides a parallel version for the slurp routine. I'm not sure why or where to look, running MCE via cmpthese reports inaccurately with MCE being 300x faster which is wrong. So, I needed to benchmark another way.

      Regarding MCE, workers receive the next chunk and tally using a local hash. Then, update the shared hash.

      use strict; use warnings; use MCE; use MCE::Shared; use String::Random 'random_regex'; use Time::HiRes 'time'; my $fn = 'dna.txt'; my $POS = 10; my $shrcount = MCE::Shared->hash(); my $mce; unless ( -e $fn ) { open my $fh, '>', $fn; print $fh random_regex( '[ACTG]{42}' ), "\n" for 1 .. 1e6; } sub slurp { open my $fh, '<', $fn; my $s = do { local $/ = undef; <$fh> }; my $count; $count-> { substr $s, $POS - 1 + 43 * $_, 1 }++ for 0 .. length( $s ) / 43 - 1; return $count } sub mce { unless ( defined $mce ) { $mce = MCE->new( max_workers => 4, chunk_size => '300k', use_slurpio => 1, user_func => sub { my ( $mce, $slurp_ref, $chunk_id ) = @_; my ( $count, @todo ); $count-> { substr ${ $slurp_ref }, $POS - 1 + 43 * $_, 1 }++ for 0 .. length( ${ $slurp_ref } ) / 43 - 1; # Each key involves one IPC trip to the shared-manager. # # $shrcount->incrby( $_, $count->{$_} ) # for ( keys %{ $count } ); # The following is faster for smaller chunk size. # Basically, send multiple commands at once. # push @todo, [ "incrby", $_, $count->{$_} ] for ( keys %{ $count } ); $shrcount->pipeline( @todo ); } )->spawn(); } $shrcount->clear(); $mce->process($fn); return $shrcount->export(); } for (qw/ slurp mce /) { no strict 'refs'; my $start = time(); my $func = "main::$_"; $func->() for 1 .. 3; printf "%5s: %0.03f secs.\n", $_, time() - $start; } __END__ slurp: 0.487 secs. mce: 0.149 secs.
Re^2: Faster and more efficient way to read a file vertically
by LanX (Saint) on Nov 05, 2017 at 21:48 UTC
    > unpack  => sub { # Suggested but not implemented by pryrt

    Actually unpack was suggested (and not implemented) by me first. ;)

    FWIW: My idea was to unpack multiple lines simultaneously instead of going line by line.

    If you are interested and all lines really have the same length (the OP never clarified)

    • read a chunk of complete lines bigger 4 or 8kb (depending on the blocksize of the OS to optimize read operations)
    • run a repeated unpack pattern
    • get a list of 1 result for each chunk line

    Please see if substr on single lines is still faster then.

    $line_length += $newline_length; # OS dependend $line_count = int(8 * 1024 / $line_length) +1; $chunk_size = $line_count * line_length;

    And yes I'm still reluctant to implement it, smells too much like an XY Problem :)

    Cheers Rolf
    (addicted to the Perl Programming Language and ☆☆☆☆ :)
    Je suis Charlie!

    update

    In hindsight... probably having a slightly smaller chunk is more efficient :

    $line_count   = int(8 * 1024 / $line_length)

      Actually unpack was suggested (and not implemented) by me first. ;)

      Ah! Sorry, I missed that :-/

      Cheers,

      JohnGG

        >Ah! Sorry, I missed that :- /

        No problem at all... ;-)

        I just wanted to point you to the possibility that unpack can process many lines at the same time, (which essentially means "reading vertically").

        use strict; use warnings; my $line_count = 10; my $line = join ("", 'a'..'z',"A".."Z") . "\n"; my $file= "$line" x $line_count; my $offset = 2; my $rest = length($line) - $offset -1; my $fmt = qq{(x${offset}ax${rest})${line_count}}; my @results = unpack $fmt, $file; print @results;

        Will print cccccccccc because of offset 2

        Cheers Rolf
        (addicted to the Perl Programming Language and ☆☆☆☆ :)
        Je suis Charlie!