Just post about 20 lines here, enclosed in a code block, instead of using a posting service that requires an email address.

Try adding an error message as an "else" part to the "if" test to see if there are any invalid lines in the input file.

No leading whitespaces anywhere in input file. I just opened it with a text editor and checked

But I just remembered that real life DNA sequences also often have N in addition to A/T/G/C. these have to be accounted for as well, right?

However, in my input sequences, having Ns versus NOT having them did not appear to make a difference in my test runs using the following input example

>Chr1
CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAAT
>Chr2
TATGACGTTTAGGGACGATCTTAATGACGTTTAGGGTTTTATCGATCAGCGACGTAGGGA
>Chr3
GTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTT
>Chr4
AACAAGGTACTCTCATCTCTTTACTGGGTAAATAACATATCAACTTGGACCTCATTCATA
>Chr5
AACATGATTCACACCTTGATGATGTTTTTAGAGAGTTCTCGTGTGAGGCGATTCTTGAGG
[download]

It'd be strange if it worked for you, because it is not working for me! Output file is always empty - whether it be with large file size, real-life input sequences, or small example ones like above, Or with or without N characters, in addition to the A, C, G, T

For example above, I even changed window length to 10

I'm not sure what is happening! Perhaps you can share the code that works with this example (script version using in and out file handles)

Sorry for the bother, but thanks

It's your fault :)

In your original post, you showed the input as LOWER CASE. Your actual data file has input in UPPER CASE.

Here's a version that handles upper case.

#!/usr/bin/perl

# https://perlmonks.org/?node_id=1228191

use strict;
use warnings;

my $window = 1e6;
my $A = my $C = my $G = my $all = 0;
my (@sizes, $tmp, $start);
my $inputfile = shift //  'd.1228191';
my $outputfile = shift // 'd.out.1228191';

open my $in, '<', $inputfile or die "$! opening $inputfile";
open my $out, '>', $outputfile or die "$! opening $outputfile";

sub letter
  {
  my $n = int rand $all--;
  $n < $A ? ($A--, return 'A') :
    $n < $A + $C ? ($C--, return 'C') :
    $n < $A + $C + $G ? ($G--, return 'G') :
    return 'T';
  }

sub output
  {
  for my $count ( @sizes )
    {
    print $out ">ID", $start++, "\n", map(letter(), 1 .. $count), "\n"
+;
    }
  @sizes = ();
  }

while( <$in> )
  {
  if( /^>/ )
    {
    $start //= s/\D+//gr;
    }
  elsif( /^[ACGT]/ )
    {
    $A += tr/A//;
    $C += tr/C//;
    $G += tr/G//;
    $all += $tmp = tr/ACGT//;
    push @sizes, $tmp;
    $all >= $window and output();
    }
  }
$all and output();
close $in;
close $out;
[download]