Just to compliment the DNA Obfu of Ranna, here's my own first obfu, dnareader.pl:
#!/usr/bin/perl # Run as dnareader.pl TCCCTCATTGAATCCAAACC # You'll get a ++ from me if you can make it say "perl" # instead. $"='ATCG'; foreach (split '', shift) { $;++;$,=$,<<2|index $",$_; next if $;&3;$,=print chr $,;$,--; }
I know, the obfuscation isn't that hard, but I think it's a cool idea anyway.
Thanks,
James Mastros,
Just Another Perl Scribe
|
|---|
| Replies are listed 'Best First'. | |
|---|---|
|
Re: DNA that is a JAPH
by grinder (Bishop) on Jan 15, 2002 at 00:04 UTC | |
by theorbtwo (Prior) on Jan 15, 2002 at 00:09 UTC | |
by patgas (Friar) on Jan 15, 2002 at 02:44 UTC | |
|
Re: DNA that is a JAPH
by patgas (Friar) on Jan 15, 2002 at 00:53 UTC | |
by theorbtwo (Prior) on Jan 15, 2002 at 00:59 UTC | |
|
Re: DNA that is a JAPH
by o(o_o)o (Scribe) on Jan 15, 2002 at 01:12 UTC | |
|
Re: DNA that is a JAPH
by Ranna (Acolyte) on Jan 16, 2002 at 09:44 UTC | |
|
Re: DNA that is a JAPH
by theorbtwo (Prior) on Sep 11, 2004 at 16:32 UTC |