Goodday Fine Monks,

I am working on a script that uses LWP to submit a form via POST to a cgi and collect the results. I realize that this topic has been covered before, and many have suggested perldoc lwpcook, which I have read. Nevertheless, I feel I must be missing something, as my script still does not work. At the moment I am getting an error message that looks like this:

500 (Internal Server Error) Not a SCALAR reference

Client-Date: Mon, 04 Mar 2002 20:42:13 GMT
[download]

I assume the not a SCALAR reference is coming straight from perl, as it is trying to print something that doesn't exist.

I am designing this to work on an internal server, but I changed my non working script to run against a similarly configured server at UCSF. Please don't everybody run this script against their server, as I haven't cleared it with them, so if 100 of us hit it all at once, it may go down.

Ok, here the script:

#!/usr/bin/perl -w
use strict;
use Getopt::Std;
use LWP::UserAgent;
use HTTP::Request::Common qw(POST);
use vars qw($ua);

my %opts;

getopts('hp:d:i:o:e:v:b:F:', \%opts);

my $PROGRAM = $opts{'p'};
my $DB      = $opts{'d'};
my $INFILE  = $opts{'i'};
my $OUTFILE = $opts{'o'};

my $ESCORE;
my $V;
my $B;
my $F;

if (defined $opts{'e'}) {
    $ESCORE=$opts{'e'};
} else {
    $ESCORE=0.01;
}
if (defined $opts{'v'}) {
    $V=$opts{'v'};
} else {
    $V=10;
}
if (defined $opts{'b'}) {
    $B=$opts{'b'};
} else {
    $B=10;
}
if (defined $opts{'F'}) {
    $F=$opts{'F'};
} else {
    $F='T';
}

#--------------------------------------------------------------
my $seq="GCAGCAGGTCGGTAGGCGGGAAATGGCGACTGGCTGAAGGAGCTGGTTCTGTTGCTGCTGC
+GGGGTAAGCGGGAAAGACACCACACA";

$DB = 'baygenomicsdb';
$ua = LWP::UserAgent->new;

my $req = HTTP::Request->new(POST => 'http://baygenomics.ucsf.edu/db/c
+gi-bin/blast/blast.cgi');
$req->content_type('form-data'); #also tried 'application/x-www-form-u
+rlencoded'

$req->content( [ PROGRAM => $PROGRAM, DATALIB => $DB,
                 SEQUENCE => $seq,
                 EXPECT  => $ESCORE,
                 DESCRIPTIONS => $V, ALIGNMENTS => $B ]);

print $ua->request($req)->as_string;
[download]

The script get executed like this on the command line:

$ ./test-post.pl -p blastn -d hs_all.fa -i test.in -o test.out
[download]

Currently, the -d, -i and -o flags are not used even though they are specified.

Thanks for your time.
Scott