Adding characters to the beginning of a file

lady has asked for the wisdom of the Perl Monks concerning the following question:

I have created a program that selects the DNA from a genbank file. However, I need to turn this DNA into fasta format which means creating a line that looks like this:

> Gene name
GCGATGCTAGTCGTAGTCATGCAGG
CGGATTGT
[download]

I need to find out how to add the '>' symbol to the start of a file. I have been thinking so hard my brain hurts. Can it be done with a regular expression?? I know you can substitute characters, but can you add them?? Thanks.

Comment on Adding characters to the beginning of a file Download Code

Replies are listed 'Best First'.
Re: Adding characters to the beginning of a file by belg4mit (Prior) on Apr 17, 2002 at 13:34 UTC
Please see How do I change one line in a file/delete a line in a file/insert a line in the middle of a file/append to the beginning of a file?. Short answer you can't. Long answer, of course you can but it takes a teeny bit of work. `-- perl -pe "s/\b;([mnst])/'\1/mg"`	[reply]
Re: Adding characters to the beginning of a file by tachyon (Chancellor) on Apr 17, 2002 at 15:25 UTC
Perl of course has a one liner for this using the inplace edit feature. This does the trick (and writes a backup file of the original with a .bak appended just in case :-) `perl -pi.bak -e '$begin++ \|\| s/^/>/' dna.txt` [download] This does what you have to do. Read the file in and write out a new modified file. You need to use " instead of ' on Win32. cheers tachyon s&&rsenoyhcatreve&&&s&n.+t&"$'$`$\"$\&"&ee&&y&srve&&d&&print	[reply] [d/l]