Re: a farewell to chop

I like using chop to do this sort of thing (I am a bioinformaticist):

my $dna = 'gagagtatgcgattaatgcatattataaaaagcggcatgacggca';

for (1..10) 
{
    my $base = chop($dna);
    print "$base\n";
}
[download]

Regards,

Helgi Briem

Comment on Re: a farewell to chop Download Code

Replies are listed 'Best First'.
Re^2: a farewell to chop by Aristotle (Chancellor) on Sep 12, 2002 at 14:53 UTC
You can do better without `chop` there, though.. `print "$_\n" for reverse split //, substr($dna, -10);` And if you need `$dna` to loose the last characters, `print "$_\n" for reverse split //, substr($dna, -10, 10, '');` Brackets not necessary here, but added for readability. Makeshifts last the longest.	[reply] [d/l] [select]