Anonymous Monk has asked for the wisdom of the Perl Monks concerning the following question:
I also have an array containing numbers to match some of the gene records (@numbers).e.g. >gb|203-3411 ctacttactgtgactactgtgactgactgtgcatgacg catcatgcatgtgacttgactgactgatgctgactgct >gb|4670-5490 ctactgtgactgacttgactgactgtgactgtgctgac catgcagtactacttactgagtacgtctgtgcgt
I want to simply extract all genes whose positions are in the numbers array. So the desired output would be this:e.g. 456-3210 4670-5490
Please could someone explain how this can be done. Many Thanks, AM>gb|4670-5490 ctactgtgactgacttgactgactgtgactgtgctgac catgcagtactacttactgagtacgtctgtgcgt
|
|---|
| Replies are listed 'Best First'. | |
|---|---|
|
Re: Iterating through files and arrays simultaneously
by dragonchild (Archbishop) on Oct 06, 2003 at 16:39 UTC | |
|
Re: Iterating through files and arrays simultaneously
by broquaint (Abbot) on Oct 06, 2003 at 16:50 UTC | |
|
Re: Iterating through files and arrays simultaneously
by stajich (Chaplain) on Oct 06, 2003 at 18:19 UTC | |
|
Re: Iterating through files and arrays simultaneously
by flounder99 (Friar) on Oct 06, 2003 at 17:51 UTC |