in reply to combining RegEx
You want to recognise both RE1 and RE2. The string begins with SW, followed by either an optional '=' or a mandatory ':', any nunmber of spaces, and then the bit you want to capture, any continuous sequence of letters, numbers or puunctuation other than ';' and ','. Assuming the two RE work separately, you can combine them most easily with:
/SW[=:]?\s*([^\s;,\n\r]+)/
which looks for either '=' or ':' or neither.
--
TTTATCGGTCGTTATATAGATGTTTGCA
|
|---|