It helped both my coding style and efficiency, thank you! I have a question, if I only wanted to get the 3-triplet amino acid sequence for each start/stop sequence, and not translate it, I modified the code but can't figure out what I'm doing wrong. The string is passed to the while loop, the conditions are checked to terminate and match for the start of the substring, the substring is passed to the subroutine. Inside the subroutine, it enters a for loop, where it makes a substring $codon, if codon matches a regex termination pattern, it returns $dna_string. Here's the code:
#!/usr/bin/perl -w
use strict;
my $s1 = "AGCCATGTAGCTAACTCAGGTTACATGGGGATGACCCCGCGACTTGGATTAGAGTCTCTT
+";
print "$s1\n";
my $idx = -1;
my $start = 'ATG';
while (my $prefix = substr($s1, ++$idx, 3)) {
last if length $prefix < 3;
# check for start indicator
next unless $prefix eq 'ATG';
my $peptide = proteinseq(substr($s1, $idx));
print "$peptide\n";
}
sub proteinseq {
my ($dna) = @_;
my $dna_seq = '';
for (my $i; $i < length($dna)-2; $i +=3) {
my $codon = substr($dna, $i, 3);
print "$codon\t";
return $dna_seq if ($codon =~ /TA[GA]|TGA/);
$dna_seq .= $codon;
}
}
Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
Read Where should I post X? if you're not absolutely sure you're posting in the right place.
Please read these before you post! —
Posts may use any of the Perl Monks Approved HTML tags:
- a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
| |
For: |
|
Use: |
| & | | & |
| < | | < |
| > | | > |
| [ | | [ |
| ] | | ] |
Link using PerlMonks shortcuts! What shortcuts can I use for linking?
See Writeup Formatting Tips and other pages linked from there for more info.