Hi, I'm a beginner to perl programming. I need to create a script for removing the nucleotides from many sequences. My data looks something like this

@HWI-.blah blah.......................:TGACCA

GTAGGGGCTGCGCGAACGCAAACCCCCGCTGCCACAAATGATCGTCGGACTGTAGAA

CTCTGAACGTGTAGATCTCGGTGGCCGCCGTATCATTAAAAAAA

+

?1=.....blah blah......................................>(:@@CB+8(9>@:@CCBB289(259@B9B8?A:@C@>CC@B

this is like one set, there are many sets like this in the file. so if i want to remove the last 5 "a" frm the sequence, and its corresponding quality (>CC@B) and do this for all the sequences, how do i go about it. First I thought i should split it into arrays using the '+' but then i will have to remove the last five elements of each element of the array. and join them and resplit them differently so that the next time i can remove the last 5"quality" data from each element of the array. I'm sure there's a less complicated procedure..can anyone help mme out here please?

@HWI-ST1023:184:C1V8LACXX:7:1101:1142:2247 2:N:0:TGACCA
GTAGGGGCTGCGCGAACGCAAACCCCCGCTGCCACAAATGATCGTCGGACTGTAGAACTCTGAACGTGTA
+GATCTCGGTGGCCGCCGTATCATTAAAAAAA
+
?1=DBB@DCFFFFIGIIII6DGHHIII6@=AEEDDEEC;@C>@?(;;B;@B?9BCDAA3>(:@@CB+8(9
+>@:@CCBB289(259@B9B8?A:@C@>CC@B

@HWI-ST1023:184:C1V8LACXX:7:1101:1450:2022 2:N:0:TGACCA
ACGTGCCCTCGGCCAGAAGGCTTGGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCA
+ATTCACACCAAGTATCGCATTTCGCTACGTT
+
?@@DDDFFADFFHIJIIFG>FHIJJJJJGIIBH=DHGHHDDFFF;
AEAC?=>CD-:@CDBDBDBDD>CDDD:ACDCDDDDD?(4>CBBD?@DDDDDDDD8?

@HWI-ST1023:184:C1V8LACXX:7:1101:1457:2047 2:N:0:TGACCA
GCGTCGCCAGCACAGAGGCCATGCGATCCGTCGAGTTATCATGAATCATCAGAGCAACGGGCAGAGCCCG
+CGTCGACCTTTTATCTAATAAATGCGTCCCT
+
@CCDFFFFGHHHHJIIIJJIJJJJIIJJJJFHIBFBFHIGJJIGI@GHGGEHHHHHHFFDDABDDDDDDD
+DDDDBDBBBDCCCCCDDDDCDDEECB8<@DD

[download]

sorry if I framed my question wrong

So i need to remove the last 5 Nucleotides from each sequence, irrespective of whether its an "a" or not, sorry if i said so otherwise.

Also i need to remove the corresponding quality of the nucleotides which are basically the symbol like characters.Like in the first sequence if I'm removing "AAAAA" i need to also remove ">CC@B".

is it doable? :(

In reply to Removing nucleotide frm sequence by bingalee

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.