Not sure what you want, really, but to remove the last 5 chars from a $string, you can do 

substr( $string, -5, 5 ) = '';

[download]

UPDATE: I am still not sure what you want but it seems that there are groups of 4 lines and you want to shorten the second and fourth line of each group by 5 chars? 

use strict;
use warnings;
use Data::Dumper;

my @lines = <DATA>; # assume groups of four lines
chomp( @lines );
my $n = 5;          # to be cut off
for( my $i=0; $i<@lines; $i+=4 ) {
        substr( $lines[$i+1], -$n, $n ) = '';
        substr( $lines[$i+3], -$n, $n ) = '';
}
print Dumper( \@lines );

__DATA__
@HWI-ST1023:184:C1V8LACXX:7:1101:1142:2247 2:N:0:TGACCA
GTAGGGGCTGCGCGAACGCAAACCCCCGCTGCCACAAATGATCGTCGGACTGTAGAACTCTGAACGTGTA
+GATCTCGGTGGCCGCCGTATCATTAAAAAAA
+
?1=DBB@DCFFFFIGIIII6DGHHIII6@=AEEDDEEC;@C>@?(;;B;@B?9BCDAA3>(:@@CB+8(9
+>@:@CCBB289(259@B9B8?A:@C@>CC@B
@HWI-ST1023:184:C1V8LACXX:7:1101:1450:2022 2:N:0:TGACCA
ACGTGCCCTCGGCCAGAAGGCTTGGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCA
+ATTCACACCAAGTATCGCATTTCGCTACGTT
+
?@@DDDFFADFFHIJIIFG>FHIJJJJJGIIBH=DHGHHDDFFF;AEAC?=>CD-:@CDBDBDBDD>CDD
+D:ACDCDDDDD?(4>CBBD?@DDDDDDDD8?
@HWI-ST1023:184:C1V8LACXX:7:1101:1457:2047 2:N:0:TGACCA
GCGTCGCCAGCACAGAGGCCATGCGATCCGTCGAGTTATCATGAATCATCAGAGCAACGGGCAGAGCCCG
+CGTCGACCTTTTATCTAATAAATGCGTCCCT
+
@CCDFFFFGHHHHJIIIJJIJJJJIIJJJJFHIBFBFHIGJJIGI@GHGGEHHHHHHFFDDABDDDDDDD
+DDDDBDBBBDCCCCCDDDDCDDEECB8<@DD

[download]

In reply to Re: Removing nucleotide frm sequence by hdb
in thread Removing nucleotide frm sequence by bingalee

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.