I am trying to capture the very short string after the 'atg' and before (not including) either 'taa', 'tag', or 'tga'.

The very short string (three nucleotides) are those after the first 'atg' and before any of the three stop codons (in DNA form, i.e., before transcription has occurred)...in other words 'gga' since the 'taa' which immediately follows should (ideally) prevent further matching.

For example: 

$dna = q/attatcgatgaaattagggctaatctcgcggggcctat/;
                ^-^          ^-^
               match   match and exit

[download]


The characters (nucleotides) between the markers (and only these) should be captured and accessible in $1.

In reply to Re^2: Simple regex question. Grouping with a negative lookahead assertion. by Anonymous Monk
in thread Simple regex question. Grouping with a negative lookahead assertion. by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.