Just one question: In the sequence  'atgaaaaa' (which is not terminated by any of (taa|tag|tga)), what should be matched? From the discussion in the thread so far, I assume the answer is 'nothing'.

With that assumption in hand, here's a small variation on BrowserUk's approach, which is easily adapted to capture all kinds of info about each match. This needs Perl version 5.10+ for  ${^MATCH} and  \K and the  //p regex modifier. If only the matching sub-sequences are needed, it can capture directly to an array. Because it does not use capture groups, it may be slightly faster, but I have not Benchmark-ed this. 

>perl -wMstrict -le
"my $dna = 'atctcggataatgggataaaaatataggctataaatggcgccccggctaattttt';
 ;;
 my @sub_seqs;
 push @sub_seqs, [ ${^MATCH}, $-[0] ]
   while $dna =~ m{ atg \K  [acgt]+?  (?= taa | tag | tga) }xmspg;
 ;;
 printf qq{%d sub-sequence(s) \n}, scalar @sub_seqs;
 ;;
 print $dna if @sub_seqs;
 for my $ar_sub_seq (@sub_seqs) {
   my $cursor =
     ('-' x $ar_sub_seq->[1]) . ('^' x length $ar_sub_seq->[0]);
   print $cursor;
   }
 ;;
 my @ss = $dna =~ m{ atg \K  [acgt]+?  (?= taa | tag | tga) }xmspg;
 printf qq{'$_'  } for @ss;
"
2 sub-sequence(s)
atctcggataatgggataaaaatataggctataaatggcgccccggctaattttt
-------------^^^
-------------------------------------^^^^^^^^^^
'gga'  'gcgccccggc'

[download]

In reply to Re: Simple regex question. Grouping with a negative lookahead assertion. by AnomalousMonk
in thread Simple regex question. Grouping with a negative lookahead assertion. by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.