Hi all.

I am attempting to extract the Name and Nucleotide Sequence information from a file which has the following format:

GeneID: 1002 Name: cadherin 4, type 1, R-cadherin (retinal) Chromo: 20 Cytoband: 20q13.3 Nucleotide Sequence: atgaccgcgggcgccggcgtgctccttctgctgctctcg acagcgagactggagatatcgtcacagtggcggctggcctggaccgagagaaagttcagc cagcttgcgcatcctgtacctggaggccgggatgtatgacgtccccatcatcgtcacaga


The code I wrote to accomplish this seemingly simple task is below:

#!/usr/bin/perl -w use strict; use autodie; open FH, '<', 'test.dat'; my @data = <FH>; close FH; open FH2, '>', 'seq.dat'; for (@data) { if (/Name:\s(.*?).*Nucleotide\sSequence:\s(.*?)/xms) { print FH2 $1, $2, "\n\n"; } } close FH2;


Ideally, the output file will consist of a collection of two rows in the following format (where 'blah' is the name and 'foo' is the sequence):

blah
foo

blah
foo

...

Thanks for the help.

In reply to Extracting multiple rows in a text file with a regex. by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.