Hey there. So a common trick is to use the $/ perl variable. It enables you to read input data record-by-record instead of by line. When set to "" the input will be read as blocks that are separated by empty lines. So, with the input file you provided:

use strict; use autodie; open my $FH, '<', 'test.dat'; open my $FH2, '>', 'seq.dat'; for (do {local $/ = ""; <$FH>}) { my ($name) = /Name:\s+(.+)/; my ($seq) = /Nucleotide\sSequence:\s(.*)/xms; $seq =~ s/\n//g; print $FH2 "$name\n$seq\n\n"; }
Produces:
cadherin 4, type 1, R-cadherin (retinal) atgaccgcgggcgccggcgtgctccttctgctgctctcgctctccggcacagcgagactggagatatcgt +cacagtggcggctggcctggaccgagagaaagttcagcagtacacagcagcttgcgcatcctgtacctg +gaggccgggatgtatgacgtccccatcatcgtcacagactctggaaa tetraspanin 32 atggggccttggagtcgagtcagggttgccaaatgccagatgctggtc tumor suppressing subtransferable candidate 4 atggctgaggcaggaacaggtgagccgtcccccagcgtggagggcgaa

In reply to Re^3: Extracting multiple rows in a text file with a regex. by Loops
in thread Extracting multiple rows in a text file with a regex. by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.