The regex needs to specify where each of the two capture groups ends:

use strict;
use warnings;
use autodie;

$_ = do { local $/; <DATA> };

while (/
         Name: \s+ (.*?) $                  # $ ends 1st capture at en
+d-of-line
         .*?                                # (ignored)
         Nucleotide \s+ Sequence: \s+ (.*?) # 2nd capture group...
         (?: GeneID | \z)                   #   terminated by 'GeneID'
+ or
                                            #   end-of-string
       /gmsx)
{
    my   ($name, $seq) = ($1, $2);
    chomp($name, $seq);
    print "\n$name\n\n$seq\n";
}

__DATA__
GeneID: 1002
Name: cadherin 4, type 1, R-cadherin (retinal)
Chromo: 20
Cytoband: 20q13.3
Nucleotide Sequence: atgaccgcgggcgccggcgtgctccttctgctgctctcgctctccggc
acagcgagactggagatatcgtcacagtggcggctggcctggaccgagagaaagttcagcagtacacag
cagcttgcgcatcctgtacctggaggccgggatgtatgacgtccccatcatcgtcacagactctggaaa

GeneID: 10077
Name: tetraspanin 32
Chromo: 11
Cytoband: 11p15.5
Nucleotide Sequence: atggggccttggagtcgagtcagggttgccaaatgccagatgctggtc

GeneID: 10078
Name: tumor suppressing subtransferable candidate 4
Chromo: 11
Cytoband: 11p15.5
Nucleotide Sequence: atggctgaggcaggaacaggtgagccgtcccccagcgtggagggcgaa

[download]

Output:

18:24 >perl 675_SoPW.pl

cadherin 4, type 1, R-cadherin (retinal)

atgaccgcgggcgccggcgtgctccttctgctgctctcgctctccggc
acagcgagactggagatatcgtcacagtggcggctggcctggaccgagagaaagttcagcagtacacag
cagcttgcgcatcctgtacctggaggccgggatgtatgacgtccccatcatcgtcacagactctggaaa


tetraspanin 32

atggggccttggagtcgagtcagggttgccaaatgccagatgctggtc


tumor suppressing subtransferable candidate 4

atggctgaggcaggaacaggtgagccgtcccccagcgtggagggcgaa

18:24 >

[download]

Note the while loop used in conjunction with the /g modifier on the regex — see “Global matching” in Using regular expressions in Perl.

Hope that helps,

Athanasius <°(((>< contra mundum Iustus alius egestas vitae, eros Piratica,

In reply to Re^3: Extracting multiple rows in a text file with a regex. by Athanasius
in thread Extracting multiple rows in a text file with a regex. by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.