If you don't want to "slurp" in the whole file at once:
my $name; my $seq; while (<DATA>) { chomp; if (s/^Name:\s*//) { $name= $_; next; } if (s/^Nucleotide Sequence:\s*//) { $seq= $_; while (<DATA>) { last if /^s*$/; chomp; $seq.= $_; } print "$name\n$seq\n\n"; } } __DATA__ GeneID: 1002 Name: cadherin 4, type 1, R-cadherin (retinal) Chromo: 20 Cytoband: 20q13.3 Nucleotide Sequence: atgaccgcgggcgccggcgtgctccttctgctgctctcgctctccggc acagcgagactggagatatcgtcacagtggcggctggcctggaccgagagaaagttcagcagtacacag cagcttgcgcatcctgtacctggaggccgggatgtatgacgtccccatcatcgtcacagactctggaaa GeneID: 10077 Name: tetraspanin 32 Chromo: 11 Cytoband: 11p15.5 Nucleotide Sequence: atggggccttggagtcgagtcagggttgccaaatgccagatgctggtc GeneID: 10078 Name: tumor suppressing subtransferable candidate 4 Chromo: 11 Cytoband: 11p15.5 Nucleotide Sequence: atggctgaggcaggaacaggtgagccgtcccccagcgtggagggcgaa
In reply to Re: Extracting multiple rows in a text file with a regex.
by Skeeve
in thread Extracting multiple rows in a text file with a regex.
by Anonymous Monk
| For: | Use: | ||
| & | & | ||
| < | < | ||
| > | > | ||
| [ | [ | ||
| ] | ] |